Incidental Mutation 'R8947:Clic5'
ID 713543
Institutional Source Beutler Lab
Gene Symbol Clic5
Ensembl Gene ENSMUSG00000023959
Gene Name chloride intracellular channel 5
Synonyms 5730531E12Rik, nmf318
MMRRC Submission 068785-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8947 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 44445671-44591059 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to T at 44553148 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024755]
AlphaFold Q8BXK9
Predicted Effect probably benign
Transcript: ENSMUST00000024755
SMART Domains Protein: ENSMUSP00000024755
Gene: ENSMUSG00000023959

DomainStartEndE-ValueType
Pfam:GST_N_3 28 100 2.4e-10 PFAM
Pfam:GST_C_2 90 220 1e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chloride intracellular channel (CLIC) family of chloride ion channels. The encoded protein associates with actin-based cytoskeletal structures and may play a role in multiple processes including hair cell stereocilia formation, myoblast proliferation and glomerular podocyte and endothelial cell maintenance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit head bobbing and circling behavior, inability to swim, and complete deafness by 7-8 months of age caused by dysmorphic stereocilia and progressive hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,665,292 (GRCm39) F141L unknown Het
A2ml1 G T 6: 128,529,219 (GRCm39) N974K probably damaging Het
Abcg8 T C 17: 84,999,246 (GRCm39) L114P probably damaging Het
Akt3 A T 1: 176,958,645 (GRCm39) W22R probably damaging Het
Ank2 C T 3: 126,736,396 (GRCm39) probably benign Het
Ap1g1 C T 8: 110,589,964 (GRCm39) probably benign Het
Arhgef19 T A 4: 140,973,618 (GRCm39) V35E possibly damaging Het
Baz2b T C 2: 59,778,583 (GRCm39) D759G probably benign Het
BC051665 C A 13: 60,930,004 (GRCm39) G320W probably damaging Het
Bche T A 3: 73,608,761 (GRCm39) T222S probably damaging Het
C8a T C 4: 104,679,326 (GRCm39) D444G probably damaging Het
Cacna1e A T 1: 154,277,896 (GRCm39) S2019T probably benign Het
Carm1 T C 9: 21,497,749 (GRCm39) I373T probably damaging Het
Ccdc39 T C 3: 33,869,609 (GRCm39) probably benign Het
Cntn3 A G 6: 102,414,864 (GRCm39) F28L probably damaging Het
Col6a5 C T 9: 105,822,833 (GRCm39) E175K unknown Het
Cpb2 T C 14: 75,515,627 (GRCm39) Y352H probably damaging Het
Cpeb3 A T 19: 37,152,366 (GRCm39) D3E probably damaging Het
Ctsl T C 13: 64,514,840 (GRCm39) T155A probably damaging Het
Cygb C T 11: 116,540,645 (GRCm39) A114T probably damaging Het
Cyp11a1 T C 9: 57,924,738 (GRCm39) V17A probably benign Het
Dhcr7 T G 7: 143,400,959 (GRCm39) I374S probably damaging Het
Dhx36 T C 3: 62,380,387 (GRCm39) R807G probably benign Het
Diaph1 A T 18: 37,986,754 (GRCm39) V1077E probably damaging Het
Ehmt2 A G 17: 35,127,280 (GRCm39) E131G possibly damaging Het
Evpl A G 11: 116,112,164 (GRCm39) I1842T probably damaging Het
Fastk C A 5: 24,646,649 (GRCm39) C294F probably damaging Het
Fndc5 T C 4: 129,030,929 (GRCm39) C20R probably benign Het
Gm7298 C A 6: 121,757,553 (GRCm39) Q1053K possibly damaging Het
Gm8362 A G 14: 18,151,405 (GRCm39) probably null Het
Gmps T A 3: 63,906,098 (GRCm39) I465N probably damaging Het
Heatr4 T G 12: 84,001,431 (GRCm39) M904L probably benign Het
Hhip T A 8: 80,771,785 (GRCm39) D175V probably damaging Het
Hmcn2 G A 2: 31,278,220 (GRCm39) V1641M probably damaging Het
Hoxa5 T G 6: 52,179,776 (GRCm39) T200P probably damaging Het
Ift122 C A 6: 115,901,368 (GRCm39) A1050D probably benign Het
Igf2bp2 C A 16: 21,897,473 (GRCm39) E247* probably null Het
Irak1bp1 T A 9: 82,728,846 (GRCm39) L259H probably damaging Het
Irgm1 G A 11: 48,759,575 (GRCm39) probably benign Het
Itih1 A T 14: 30,657,866 (GRCm39) probably benign Het
Itpk1 A T 12: 102,536,582 (GRCm39) C355S probably benign Het
Kcng4 T C 8: 120,352,452 (GRCm39) E486G possibly damaging Het
Kif20b T C 19: 34,918,629 (GRCm39) V671A possibly damaging Het
Kif28 T G 1: 179,544,320 (GRCm39) I345L possibly damaging Het
Klri2 C G 6: 129,710,742 (GRCm39) probably null Het
Kntc1 T C 5: 123,925,041 (GRCm39) V1118A probably benign Het
Lpin2 T A 17: 71,511,871 (GRCm39) I34N probably benign Het
Lrch3 T A 16: 32,802,199 (GRCm39) V264D possibly damaging Het
Lrrk2 C T 15: 91,586,473 (GRCm39) Q430* probably null Het
Map10 T G 8: 126,397,839 (GRCm39) S411A probably benign Het
Map1a A T 2: 121,135,450 (GRCm39) I2089F probably benign Het
Med12l T A 3: 58,984,443 (GRCm39) probably benign Het
Mypn T A 10: 63,005,156 (GRCm39) Q317L probably damaging Het
Ncan T A 8: 70,555,171 (GRCm39) I999F probably damaging Het
Nmrk2 C A 10: 81,035,539 (GRCm39) R134L probably damaging Het
Or4k42 C T 2: 111,320,042 (GRCm39) V154I probably benign Het
Or51f1d T A 7: 102,701,315 (GRCm39) V270E probably damaging Het
Or5k17 T C 16: 58,746,433 (GRCm39) N167S probably benign Het
Or6z7 A G 7: 6,483,246 (GRCm39) V303A probably benign Het
Or8b1c T A 9: 38,384,685 (GRCm39) I214N probably damaging Het
Osbpl1a A G 18: 12,899,858 (GRCm39) probably null Het
Pcdh1 T C 18: 38,332,073 (GRCm39) D310G possibly damaging Het
Pkn2 C T 3: 142,517,674 (GRCm39) probably null Het
Plch1 T A 3: 63,691,547 (GRCm39) M31L probably damaging Het
Polg2 A G 11: 106,659,170 (GRCm39) F448L probably damaging Het
Ppp4r3b A G 11: 29,150,758 (GRCm39) T475A possibly damaging Het
Prdm13 C T 4: 21,678,817 (GRCm39) E558K probably damaging Het
Prdm9 T A 17: 15,764,270 (GRCm39) I837F possibly damaging Het
R3hdm1 T A 1: 128,102,694 (GRCm39) M125K possibly damaging Het
Rbm39 A T 2: 155,990,276 (GRCm39) V468E probably damaging Het
Rnasel T A 1: 153,630,777 (GRCm39) V431E probably damaging Het
Rps2 T A 17: 24,940,227 (GRCm39) D220E probably benign Het
Rsf1 T C 7: 97,331,059 (GRCm39) probably benign Het
Rsph10b G T 5: 143,913,952 (GRCm39) A710S probably benign Het
Sez6 A T 11: 77,844,353 (GRCm39) T59S probably damaging Het
Sf3b1 A T 1: 55,039,444 (GRCm39) V727E probably damaging Het
Slit2 T G 5: 48,407,140 (GRCm39) L857R probably damaging Het
Spata31g1 T A 4: 42,972,097 (GRCm39) S477T probably benign Het
Sspo T G 6: 48,425,504 (GRCm39) C42G probably damaging Het
Strc C T 2: 121,201,470 (GRCm39) D1245N probably benign Het
Supv3l1 T A 10: 62,268,118 (GRCm39) T576S probably benign Het
Tecrl C T 5: 83,461,154 (GRCm39) R101Q probably benign Het
Tmeff2 A G 1: 51,220,952 (GRCm39) Y309C probably damaging Het
Tmem43 T A 6: 91,462,362 (GRCm39) W316R probably damaging Het
Tmigd3 T C 3: 105,821,554 (GRCm39) V141A probably benign Het
Trav9-1 T C 14: 53,725,584 (GRCm39) F8L probably benign Het
Trbv5 T G 6: 41,039,641 (GRCm39) F82C probably damaging Het
Ubtf T C 11: 102,205,802 (GRCm39) N41S possibly damaging Het
Uggt1 T C 1: 36,197,229 (GRCm39) T1225A probably benign Het
Vmn1r72 T C 7: 11,403,807 (GRCm39) R214G possibly damaging Het
Vmn2r12 T G 5: 109,234,522 (GRCm39) K563N possibly damaging Het
Vmn2r83 T C 10: 79,304,873 (GRCm39) S28P probably benign Het
Vwa8 T G 14: 79,438,552 (GRCm39) L1875R probably damaging Het
Xrcc6 T A 15: 81,913,866 (GRCm39) V64E probably damaging Het
Zfp292 T C 4: 34,811,835 (GRCm39) Y403C probably damaging Het
Zfp955a A T 17: 33,460,955 (GRCm39) H392Q probably damaging Het
Zfyve19 T C 2: 119,041,290 (GRCm39) S69P probably damaging Het
Other mutations in Clic5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Clic5 APN 17 44,559,633 (GRCm39) missense probably benign 0.00
IGL03196:Clic5 APN 17 44,552,960 (GRCm39) missense possibly damaging 0.59
IGL03394:Clic5 APN 17 44,548,105 (GRCm39) missense probably benign 0.19
R0035:Clic5 UTSW 17 44,586,200 (GRCm39) missense probably damaging 1.00
R0035:Clic5 UTSW 17 44,586,200 (GRCm39) missense probably damaging 1.00
R0375:Clic5 UTSW 17 44,581,510 (GRCm39) missense possibly damaging 0.65
R2909:Clic5 UTSW 17 44,586,146 (GRCm39) missense probably benign 0.00
R4541:Clic5 UTSW 17 44,552,956 (GRCm39) missense probably damaging 1.00
R7101:Clic5 UTSW 17 44,586,179 (GRCm39) missense probably benign
R8215:Clic5 UTSW 17 44,586,228 (GRCm39) nonsense probably null
R8904:Clic5 UTSW 17 44,552,992 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CCTTCAATGGGGATGTGAAGAC -3'
(R):5'- TTGAGCTTTTCAGGAGAATAAGGC -3'

Sequencing Primer
(F):5'- CTTCAATGGGGATGTGAAGACAGATG -3'
(R):5'- CTTTTCAGGAGAATAAGGCTGGTG -3'
Posted On 2022-06-09