Incidental Mutation 'R9079:Usp20'
ID 713547
Institutional Source Beutler Lab
Gene Symbol Usp20
Ensembl Gene ENSMUSG00000026854
Gene Name ubiquitin specific peptidase 20
Synonyms 1700055M05Rik, Vdu2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9079 (G1)
Quality Score 200.009
Status Validated
Chromosome 2
Chromosomal Location 30982279-31023586 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to G at 31005108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061544] [ENSMUST00000102849] [ENSMUST00000125601] [ENSMUST00000128295] [ENSMUST00000138161] [ENSMUST00000170476]
AlphaFold Q8C6M1
Predicted Effect probably benign
Transcript: ENSMUST00000061544
SMART Domains Protein: ENSMUSP00000060167
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.2e-18 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 210 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102849
SMART Domains Protein: ENSMUSP00000099913
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 4.3e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 684 5e-63 PFAM
Pfam:UCH_1 145 669 8.8e-24 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125601
SMART Domains Protein: ENSMUSP00000121699
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 66 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128295
SMART Domains Protein: ENSMUSP00000115613
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 77 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136588
SMART Domains Protein: ENSMUSP00000119197
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 10 60 6.4e-12 PFAM
low complexity region 93 103 N/A INTRINSIC
Pfam:UCH 109 142 4.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138161
SMART Domains Protein: ENSMUSP00000116696
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 77 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170476
SMART Domains Protein: ENSMUSP00000127388
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.4e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 270 1.2e-26 PFAM
Pfam:UCH_1 145 669 6.1e-20 PFAM
Pfam:UCH 324 684 1.6e-31 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900055J20Rik A G 18: 40,257,027 probably benign Het
Atad2 A T 15: 58,125,827 S212R probably benign Het
Bcl9 A T 3: 97,205,500 V1213E probably damaging Het
Brd1 T C 15: 88,713,950 D531G probably damaging Het
Cd1d1 T A 3: 86,998,890 Y26F probably benign Het
Cep83 T C 10: 94,728,679 F160S possibly damaging Het
Cfap61 G T 2: 145,939,939 V31F probably benign Het
Cox11 G A 11: 90,644,420 M232I probably damaging Het
Cpne7 C T 8: 123,130,212 P402L probably damaging Het
Cubn A G 2: 13,287,103 S3304P probably benign Het
Eif4b T A 15: 102,094,742 D549E unknown Het
Extl1 T A 4: 134,362,664 N378Y probably damaging Het
Fam160a1 C A 3: 85,672,283 G872* probably null Het
Fbxo4 C T 15: 3,968,906 probably null Het
G430095P16Rik A T 8: 84,726,783 H133L unknown Het
Gm8138 A T 14: 43,415,045 N104K Het
Gzma A G 13: 113,096,324 F78S probably benign Het
Hars2 T C 18: 36,790,137 S400P possibly damaging Het
Hnrnpm G T 17: 33,649,801 R551S probably damaging Het
Htr5b T A 1: 121,528,087 T35S probably benign Het
Jak3 A C 8: 71,679,254 E158A probably benign Het
Kdm4c C A 4: 74,359,501 D797E probably benign Het
Klhl31 T A 9: 77,650,869 V289E probably damaging Het
Loxhd1 T C 18: 77,402,897 S1398P probably benign Het
Matn4 A T 2: 164,393,553 probably benign Het
Mrps28 A G 3: 8,802,248 *187Q probably null Het
Myh7b G A 2: 155,623,254 V677I probably damaging Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Notch3 A T 17: 32,164,059 probably benign Het
Nr1h2 C A 7: 44,550,006 E440D possibly damaging Het
Olfr364-ps1 T C 2: 37,146,977 V255A probably damaging Het
Olfr777 A T 10: 129,268,597 M242K possibly damaging Het
Olfr828 A T 9: 18,815,435 N286K probably damaging Het
Olfr971 T A 9: 39,839,473 I13N probably benign Het
Osbpl9 A T 4: 109,063,447 V543D possibly damaging Het
Pcgf6 T C 19: 47,050,614 E69G possibly damaging Het
Piezo2 A G 18: 63,024,466 L2391P probably damaging Het
Rcn2 T A 9: 56,045,109 probably benign Het
Ripor2 G A 13: 24,731,654 R1069H probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Senp5 A T 16: 31,968,900 I635N probably damaging Het
Slc30a9 A T 5: 67,326,898 K126M possibly damaging Het
Slc9b2 A T 3: 135,336,389 R476S probably damaging Het
Sptb G T 12: 76,630,680 R127S probably damaging Het
Svil T C 18: 5,056,308 S394P probably benign Het
Tjp1 A T 7: 65,301,218 I1636N possibly damaging Het
Tmem136 C T 9: 43,111,369 R230Q probably benign Het
Trio T C 15: 27,732,937 I2953V possibly damaging Het
Trove2 A C 1: 143,765,781 L314R probably damaging Het
Ttn A G 2: 76,802,390 F14107L probably damaging Het
Vmn1r123 A T 7: 21,163,054 L290F probably benign Het
Vmn1r202 T C 13: 22,501,432 M272V probably benign Het
Vmn2r97 A T 17: 18,929,378 N343Y probably benign Het
Wdr90 A T 17: 25,857,429 W45R Het
Other mutations in Usp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Usp20 APN 2 31004950 missense probably damaging 1.00
IGL01444:Usp20 APN 2 30998789 start codon destroyed probably null 1.00
IGL01601:Usp20 APN 2 31011794 missense probably benign 0.04
IGL01785:Usp20 APN 2 31017163 missense probably benign 0.02
IGL01786:Usp20 APN 2 31017163 missense probably benign 0.02
IGL02129:Usp20 APN 2 31004450 missense probably benign 0.43
IGL02147:Usp20 APN 2 31006401 missense probably damaging 1.00
IGL03396:Usp20 APN 2 31011717 missense probably benign
BB007:Usp20 UTSW 2 31010544 missense probably benign 0.21
BB017:Usp20 UTSW 2 31010544 missense probably benign 0.21
PIT4453001:Usp20 UTSW 2 31017486 missense possibly damaging 0.47
R0111:Usp20 UTSW 2 31002612 missense probably damaging 1.00
R0369:Usp20 UTSW 2 31011104 missense probably benign 0.00
R0479:Usp20 UTSW 2 31017475 missense probably benign 0.18
R0538:Usp20 UTSW 2 31004450 missense probably damaging 0.99
R1023:Usp20 UTSW 2 31007813 missense probably damaging 1.00
R1183:Usp20 UTSW 2 31011785 missense probably benign 0.17
R1635:Usp20 UTSW 2 31018818 missense probably benign 0.03
R2114:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2115:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2116:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2117:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2232:Usp20 UTSW 2 31018738 missense probably benign 0.13
R2244:Usp20 UTSW 2 31010331 missense possibly damaging 0.65
R2883:Usp20 UTSW 2 31018800 missense probably benign
R4734:Usp20 UTSW 2 31019824 missense probably benign 0.31
R5507:Usp20 UTSW 2 31010226 missense probably benign
R5770:Usp20 UTSW 2 31017508 missense probably damaging 1.00
R5862:Usp20 UTSW 2 31006449 nonsense probably null
R6315:Usp20 UTSW 2 31017758 missense possibly damaging 0.70
R7603:Usp20 UTSW 2 31011474 missense probably damaging 1.00
R7887:Usp20 UTSW 2 31020894 missense probably benign 0.34
R7930:Usp20 UTSW 2 31010544 missense probably benign 0.21
R8542:Usp20 UTSW 2 31011624 missense possibly damaging 0.94
R8965:Usp20 UTSW 2 31011785 missense possibly damaging 0.77
R9226:Usp20 UTSW 2 31017400 missense probably damaging 0.99
R9417:Usp20 UTSW 2 30983018 critical splice acceptor site probably null
R9459:Usp20 UTSW 2 31011012 missense probably damaging 0.99
Z1176:Usp20 UTSW 2 31019818 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGTTTGTAGGCCTCACAGG -3'
(R):5'- ACGTGACTGGGCTACAATGAAG -3'

Sequencing Primer
(F):5'- CTCACAGGCATGAAGAACCTGG -3'
(R):5'- TGGGCTACAATGAAGTTCCC -3'
Posted On 2022-06-15