Incidental Mutation 'R9440:Mamdc4'
ID 713564
Institutional Source Beutler Lab
Gene Symbol Mamdc4
Ensembl Gene ENSMUSG00000026941
Gene Name MAM domain containing 4
Synonyms LOC381352
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R9440 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 25453124-25461328 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25455600 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 876 (V876A)
Ref Sequence ENSEMBL: ENSMUSP00000092735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015236] [ENSMUST00000095117] [ENSMUST00000114223]
AlphaFold A2AJA7
Predicted Effect probably benign
Transcript: ENSMUST00000015236
SMART Domains Protein: ENSMUSP00000015236
Gene: ENSMUSG00000015092

DomainStartEndE-ValueType
Pfam:MBF1 4 73 4.6e-29 PFAM
HTH_XRE 80 135 1.02e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095117
AA Change: V876A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092735
Gene: ENSMUSG00000026941
AA Change: V876A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LDLa 32 58 7.33e-1 SMART
MAM 66 227 3.56e-52 SMART
LDLa 233 272 3.5e-9 SMART
MAM 254 430 3.87e-53 SMART
LDLa 461 497 2.63e-4 SMART
MAM 493 653 5.33e-5 SMART
MAM 660 819 3.68e-68 SMART
MAM 820 979 1.07e-28 SMART
MAM 980 1148 2.07e-62 SMART
transmembrane domain 1165 1187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114223
AA Change: V872A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000109861
Gene: ENSMUSG00000026941
AA Change: V872A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 28 54 7.33e-1 SMART
MAM 62 223 3.56e-52 SMART
LDLa 229 268 3.5e-9 SMART
MAM 250 426 3.87e-53 SMART
LDLa 457 493 2.63e-4 SMART
MAM 489 649 5.33e-5 SMART
MAM 656 815 3.68e-68 SMART
MAM 816 975 1.07e-28 SMART
MAM 976 1144 2.07e-62 SMART
transmembrane domain 1161 1183 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000119789
Gene: ENSMUSG00000026941
AA Change: V773A

DomainStartEndE-ValueType
LDLa 9 35 7.33e-1 SMART
MAM 43 204 3.56e-52 SMART
LDLa 210 249 3.5e-9 SMART
MAM 231 407 3.87e-53 SMART
LDLa 438 474 2.63e-4 SMART
MAM 558 717 2.27e-68 SMART
MAM 718 877 1.07e-28 SMART
MAM 878 1046 2.07e-62 SMART
transmembrane domain 1063 1085 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,499,452 (GRCm39) T1359M probably benign Het
Acacb T A 5: 114,384,085 (GRCm39) C2205S possibly damaging Het
Akap3 A G 6: 126,841,591 (GRCm39) E70G probably benign Het
Aldh1a3 C A 7: 66,068,992 (GRCm39) probably null Het
Asb4 A G 6: 5,429,817 (GRCm39) I352M probably benign Het
Bach1 C G 16: 87,516,603 (GRCm39) S381R probably benign Het
BC034090 A G 1: 155,101,961 (GRCm39) L101P probably benign Het
Bms1 A T 6: 118,382,217 (GRCm39) D440E probably benign Het
Bpifb6 A T 2: 153,747,914 (GRCm39) D191V probably benign Het
Cfap298 A T 16: 90,726,832 (GRCm39) V116E probably benign Het
Cfd T C 10: 79,726,816 (GRCm39) probably null Het
Cnot3 G A 7: 3,656,560 (GRCm39) E252K probably damaging Het
Col6a3 T C 1: 90,707,068 (GRCm39) D2622G unknown Het
Crybg2 T C 4: 133,801,602 (GRCm39) S612P probably benign Het
Cyp4b1 T C 4: 115,493,581 (GRCm39) K167R probably damaging Het
Gbp3 T C 3: 142,272,335 (GRCm39) V279A possibly damaging Het
Gipc2 T C 3: 151,833,706 (GRCm39) T192A possibly damaging Het
Gm3285 T C 10: 77,697,911 (GRCm39) V20A Het
Gorasp2 T C 2: 70,541,469 (GRCm39) probably null Het
Gpr179 A G 11: 97,229,315 (GRCm39) S947P probably benign Het
Klra5 C A 6: 129,883,686 (GRCm39) W147L possibly damaging Het
Lrch4 G A 5: 137,636,051 (GRCm39) R368Q probably damaging Het
Marf1 A C 16: 13,938,196 (GRCm39) D1433E probably benign Het
Mcm4 A T 16: 15,453,175 (GRCm39) C171* probably null Het
Micall1 C T 15: 79,011,159 (GRCm39) P510S Het
Morc3 A G 16: 93,649,975 (GRCm39) probably null Het
Mrpl28 G T 17: 26,345,266 (GRCm39) V229F possibly damaging Het
Mrps33 A T 6: 39,782,364 (GRCm39) Y52* probably null Het
Mybphl T C 3: 108,282,202 (GRCm39) I144T probably benign Het
Myom1 A G 17: 71,433,329 (GRCm39) M1657V probably benign Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,236,850 (GRCm39) probably benign Het
Or5p67 A G 7: 107,922,037 (GRCm39) I282T probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Plxna1 T C 6: 89,318,912 (GRCm39) K637R probably benign Het
Prob1 G T 18: 35,786,218 (GRCm39) L679I possibly damaging Het
Sgms2 C A 3: 131,118,718 (GRCm39) C255F probably damaging Het
Slc17a9 T C 2: 180,383,090 (GRCm39) C399R probably benign Het
Smc4 T A 3: 68,915,455 (GRCm39) probably null Het
St14 A G 9: 31,007,845 (GRCm39) L578P probably damaging Het
Tcaf3 A T 6: 42,573,906 (GRCm39) L102* probably null Het
Tex15 A G 8: 34,072,273 (GRCm39) T2607A possibly damaging Het
Trav15-2-dv6-2 T A 14: 53,886,932 (GRCm39) probably benign Het
Trip4 T C 9: 65,760,234 (GRCm39) probably null Het
Ttf1 A G 2: 28,955,709 (GRCm39) I358V probably benign Het
Uroc1 C A 6: 90,322,353 (GRCm39) S292R possibly damaging Het
Vmn1r5 T C 6: 56,962,415 (GRCm39) I30T possibly damaging Het
Vps33a A T 5: 123,703,047 (GRCm39) I192N probably damaging Het
Vps50 A G 6: 3,516,724 (GRCm39) I69V probably benign Het
Wdr97 T C 15: 76,245,064 (GRCm39) S1176P Het
Xirp1 G A 9: 119,847,203 (GRCm39) T560M probably damaging Het
Zfp512 A T 5: 31,628,359 (GRCm39) T266S possibly damaging Het
Other mutations in Mamdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mamdc4 APN 2 25,453,588 (GRCm39) missense possibly damaging 0.53
IGL01994:Mamdc4 APN 2 25,458,546 (GRCm39) missense possibly damaging 0.64
IGL02072:Mamdc4 APN 2 25,458,351 (GRCm39) missense probably damaging 1.00
IGL02193:Mamdc4 APN 2 25,454,458 (GRCm39) missense probably benign 0.02
IGL02673:Mamdc4 APN 2 25,460,066 (GRCm39) missense probably benign
IGL03048:Mamdc4 UTSW 2 25,459,084 (GRCm39) missense possibly damaging 0.67
R0135:Mamdc4 UTSW 2 25,456,932 (GRCm39) missense possibly damaging 0.71
R0481:Mamdc4 UTSW 2 25,461,228 (GRCm39) start codon destroyed probably null 0.08
R0490:Mamdc4 UTSW 2 25,453,593 (GRCm39) missense probably benign 0.01
R0609:Mamdc4 UTSW 2 25,454,205 (GRCm39) missense probably benign 0.30
R0729:Mamdc4 UTSW 2 25,460,048 (GRCm39) missense probably damaging 0.98
R1365:Mamdc4 UTSW 2 25,456,036 (GRCm39) missense probably damaging 1.00
R1533:Mamdc4 UTSW 2 25,459,759 (GRCm39) missense possibly damaging 0.71
R1671:Mamdc4 UTSW 2 25,458,235 (GRCm39) nonsense probably null
R1789:Mamdc4 UTSW 2 25,457,634 (GRCm39) missense possibly damaging 0.59
R2002:Mamdc4 UTSW 2 25,457,244 (GRCm39) missense probably damaging 1.00
R2013:Mamdc4 UTSW 2 25,453,584 (GRCm39) missense probably damaging 0.98
R2014:Mamdc4 UTSW 2 25,453,584 (GRCm39) missense probably damaging 0.98
R2056:Mamdc4 UTSW 2 25,454,180 (GRCm39) missense probably benign 0.18
R2109:Mamdc4 UTSW 2 25,459,402 (GRCm39) missense probably damaging 1.00
R2128:Mamdc4 UTSW 2 25,459,270 (GRCm39) missense probably damaging 1.00
R2185:Mamdc4 UTSW 2 25,459,704 (GRCm39) critical splice donor site probably null
R2473:Mamdc4 UTSW 2 25,456,344 (GRCm39) missense probably damaging 0.99
R2496:Mamdc4 UTSW 2 25,455,914 (GRCm39) missense probably damaging 1.00
R3818:Mamdc4 UTSW 2 25,455,785 (GRCm39) missense probably benign
R4591:Mamdc4 UTSW 2 25,454,609 (GRCm39) missense possibly damaging 0.87
R4829:Mamdc4 UTSW 2 25,455,368 (GRCm39) missense possibly damaging 0.85
R4898:Mamdc4 UTSW 2 25,460,035 (GRCm39) missense probably damaging 0.98
R5209:Mamdc4 UTSW 2 25,456,935 (GRCm39) missense probably damaging 0.97
R5268:Mamdc4 UTSW 2 25,454,702 (GRCm39) missense possibly damaging 0.95
R5490:Mamdc4 UTSW 2 25,455,890 (GRCm39) missense probably damaging 1.00
R6152:Mamdc4 UTSW 2 25,457,451 (GRCm39) missense probably damaging 1.00
R6234:Mamdc4 UTSW 2 25,460,092 (GRCm39) missense probably damaging 1.00
R6681:Mamdc4 UTSW 2 25,457,756 (GRCm39) missense probably damaging 1.00
R6774:Mamdc4 UTSW 2 25,456,948 (GRCm39) missense probably benign 0.06
R7178:Mamdc4 UTSW 2 25,458,977 (GRCm39) missense probably benign 0.04
R7225:Mamdc4 UTSW 2 25,455,558 (GRCm39) missense possibly damaging 0.50
R7451:Mamdc4 UTSW 2 25,454,473 (GRCm39) missense possibly damaging 0.80
R7520:Mamdc4 UTSW 2 25,455,360 (GRCm39) missense possibly damaging 0.88
R7627:Mamdc4 UTSW 2 25,458,225 (GRCm39) missense probably damaging 1.00
R7875:Mamdc4 UTSW 2 25,458,677 (GRCm39) nonsense probably null
R8041:Mamdc4 UTSW 2 25,454,707 (GRCm39) missense probably damaging 1.00
R8144:Mamdc4 UTSW 2 25,457,019 (GRCm39) missense probably damaging 0.99
R8201:Mamdc4 UTSW 2 25,456,093 (GRCm39) missense probably damaging 1.00
R8213:Mamdc4 UTSW 2 25,456,368 (GRCm39) missense probably benign 0.17
R8531:Mamdc4 UTSW 2 25,457,730 (GRCm39) missense possibly damaging 0.56
R8810:Mamdc4 UTSW 2 25,458,501 (GRCm39) missense probably benign 0.01
R9069:Mamdc4 UTSW 2 25,453,371 (GRCm39) missense probably damaging 1.00
R9446:Mamdc4 UTSW 2 25,453,645 (GRCm39) missense probably benign
R9486:Mamdc4 UTSW 2 25,455,164 (GRCm39) missense probably benign 0.00
R9551:Mamdc4 UTSW 2 25,460,035 (GRCm39) missense probably damaging 0.98
R9626:Mamdc4 UTSW 2 25,458,273 (GRCm39) missense probably damaging 1.00
X0022:Mamdc4 UTSW 2 25,460,204 (GRCm39) missense probably damaging 1.00
X0025:Mamdc4 UTSW 2 25,454,698 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ATTCACTGCCCTGGTAGCTC -3'
(R):5'- AAGACTCTGACTGTGGCTTC -3'

Sequencing Primer
(F):5'- TGGTAGCTCCCAGTCCTG -3'
(R):5'- GCACCAGAGTAATGCCTCAGG -3'
Posted On 2022-06-15