Incidental Mutation 'R9440:Ogfr'
ID 713568
Institutional Source Beutler Lab
Gene Symbol Ogfr
Ensembl Gene ENSMUSG00000049401
Gene Name opioid growth factor receptor
Synonyms 2010013E17Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.526) question?
Stock # R9440 (G1)
Quality Score 127.466
Status Not validated
Chromosome 2
Chromosomal Location 180231200-180237630 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG to AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG at 180236850 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029087] [ENSMUST00000103059] [ENSMUST00000132527]
AlphaFold Q99PG2
Predicted Effect probably benign
Transcript: ENSMUST00000029087
SMART Domains Protein: ENSMUSP00000029087
Gene: ENSMUSG00000049401

DomainStartEndE-ValueType
low complexity region 7 40 N/A INTRINSIC
Pfam:OGFr_N 76 283 2.3e-111 PFAM
low complexity region 358 369 N/A INTRINSIC
internal_repeat_1 459 483 4.08e-5 PROSPERO
internal_repeat_1 576 600 4.08e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103059
SMART Domains Protein: ENSMUSP00000099348
Gene: ENSMUSG00000027570

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.7e-12 PFAM
Pfam:Collagen 58 114 4.2e-9 PFAM
low complexity region 126 162 N/A INTRINSIC
Pfam:Collagen 174 236 4.1e-12 PFAM
Pfam:Collagen 213 292 8e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.8e-11 PFAM
low complexity region 635 656 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132527
SMART Domains Protein: ENSMUSP00000128718
Gene: ENSMUSG00000027570

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.9e-12 PFAM
Pfam:Collagen 58 114 4.3e-9 PFAM
Pfam:Collagen 109 166 4.5e-8 PFAM
Pfam:Collagen 174 236 4.2e-12 PFAM
Pfam:Collagen 213 292 8.2e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 402 474 8.2e-8 PFAM
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.9e-11 PFAM
Pfam:Collagen 603 662 2.5e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for opioid growth factor (OGF), also known as [Met(5)]-enkephalin. OGF is a negative regulator of cell proliferation and tissue organization in a variety of processes. The encoded unbound receptor for OGF has been localized to the outer nuclear envelope, where it binds OGF and is translocated into the nucleus. The coding sequence of this gene contains a polymorphic region of 60 nt tandem imperfect repeat units. Several transcripts containing between zero and eight repeat units have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,499,452 (GRCm39) T1359M probably benign Het
Acacb T A 5: 114,384,085 (GRCm39) C2205S possibly damaging Het
Akap3 A G 6: 126,841,591 (GRCm39) E70G probably benign Het
Aldh1a3 C A 7: 66,068,992 (GRCm39) probably null Het
Asb4 A G 6: 5,429,817 (GRCm39) I352M probably benign Het
Bach1 C G 16: 87,516,603 (GRCm39) S381R probably benign Het
BC034090 A G 1: 155,101,961 (GRCm39) L101P probably benign Het
Bms1 A T 6: 118,382,217 (GRCm39) D440E probably benign Het
Bpifb6 A T 2: 153,747,914 (GRCm39) D191V probably benign Het
Cfap298 A T 16: 90,726,832 (GRCm39) V116E probably benign Het
Cfd T C 10: 79,726,816 (GRCm39) probably null Het
Cnot3 G A 7: 3,656,560 (GRCm39) E252K probably damaging Het
Col6a3 T C 1: 90,707,068 (GRCm39) D2622G unknown Het
Crybg2 T C 4: 133,801,602 (GRCm39) S612P probably benign Het
Cyp4b1 T C 4: 115,493,581 (GRCm39) K167R probably damaging Het
Gbp3 T C 3: 142,272,335 (GRCm39) V279A possibly damaging Het
Gipc2 T C 3: 151,833,706 (GRCm39) T192A possibly damaging Het
Gm3285 T C 10: 77,697,911 (GRCm39) V20A Het
Gorasp2 T C 2: 70,541,469 (GRCm39) probably null Het
Gpr179 A G 11: 97,229,315 (GRCm39) S947P probably benign Het
Klra5 C A 6: 129,883,686 (GRCm39) W147L possibly damaging Het
Lrch4 G A 5: 137,636,051 (GRCm39) R368Q probably damaging Het
Mamdc4 A G 2: 25,455,600 (GRCm39) V876A probably benign Het
Marf1 A C 16: 13,938,196 (GRCm39) D1433E probably benign Het
Mcm4 A T 16: 15,453,175 (GRCm39) C171* probably null Het
Micall1 C T 15: 79,011,159 (GRCm39) P510S Het
Morc3 A G 16: 93,649,975 (GRCm39) probably null Het
Mrpl28 G T 17: 26,345,266 (GRCm39) V229F possibly damaging Het
Mrps33 A T 6: 39,782,364 (GRCm39) Y52* probably null Het
Mybphl T C 3: 108,282,202 (GRCm39) I144T probably benign Het
Myom1 A G 17: 71,433,329 (GRCm39) M1657V probably benign Het
Or5p67 A G 7: 107,922,037 (GRCm39) I282T probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Plxna1 T C 6: 89,318,912 (GRCm39) K637R probably benign Het
Prob1 G T 18: 35,786,218 (GRCm39) L679I possibly damaging Het
Sgms2 C A 3: 131,118,718 (GRCm39) C255F probably damaging Het
Slc17a9 T C 2: 180,383,090 (GRCm39) C399R probably benign Het
Smc4 T A 3: 68,915,455 (GRCm39) probably null Het
St14 A G 9: 31,007,845 (GRCm39) L578P probably damaging Het
Tcaf3 A T 6: 42,573,906 (GRCm39) L102* probably null Het
Tex15 A G 8: 34,072,273 (GRCm39) T2607A possibly damaging Het
Trav15-2-dv6-2 T A 14: 53,886,932 (GRCm39) probably benign Het
Trip4 T C 9: 65,760,234 (GRCm39) probably null Het
Ttf1 A G 2: 28,955,709 (GRCm39) I358V probably benign Het
Uroc1 C A 6: 90,322,353 (GRCm39) S292R possibly damaging Het
Vmn1r5 T C 6: 56,962,415 (GRCm39) I30T possibly damaging Het
Vps33a A T 5: 123,703,047 (GRCm39) I192N probably damaging Het
Vps50 A G 6: 3,516,724 (GRCm39) I69V probably benign Het
Wdr97 T C 15: 76,245,064 (GRCm39) S1176P Het
Xirp1 G A 9: 119,847,203 (GRCm39) T560M probably damaging Het
Zfp512 A T 5: 31,628,359 (GRCm39) T266S possibly damaging Het
Other mutations in Ogfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Ogfr APN 2 180,235,355 (GRCm39) unclassified probably benign
IGL02437:Ogfr APN 2 180,231,329 (GRCm39) missense possibly damaging 0.72
IGL02602:Ogfr APN 2 180,237,230 (GRCm39) missense possibly damaging 0.85
IGL02609:Ogfr APN 2 180,234,308 (GRCm39) splice site probably benign
IGL03297:Ogfr APN 2 180,236,200 (GRCm39) missense possibly damaging 0.93
BB017:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
PIT4812001:Ogfr UTSW 2 180,237,304 (GRCm39) missense possibly damaging 0.93
R0085:Ogfr UTSW 2 180,232,830 (GRCm39) splice site probably null
R0398:Ogfr UTSW 2 180,235,492 (GRCm39) missense probably damaging 0.99
R1313:Ogfr UTSW 2 180,236,423 (GRCm39) missense probably benign
R1313:Ogfr UTSW 2 180,236,423 (GRCm39) missense probably benign
R1468:Ogfr UTSW 2 180,236,543 (GRCm39) missense probably damaging 1.00
R1468:Ogfr UTSW 2 180,236,543 (GRCm39) missense probably damaging 1.00
R4747:Ogfr UTSW 2 180,236,216 (GRCm39) missense probably damaging 0.99
R4902:Ogfr UTSW 2 180,235,518 (GRCm39) unclassified probably benign
R5422:Ogfr UTSW 2 180,237,068 (GRCm39) missense probably benign 0.02
R5422:Ogfr UTSW 2 180,237,067 (GRCm39) missense possibly damaging 0.63
R5860:Ogfr UTSW 2 180,234,285 (GRCm39) missense probably damaging 1.00
R5988:Ogfr UTSW 2 180,236,026 (GRCm39) missense probably damaging 1.00
R6015:Ogfr UTSW 2 180,236,467 (GRCm39) missense probably damaging 1.00
R6558:Ogfr UTSW 2 180,237,197 (GRCm39) missense possibly damaging 0.93
R6721:Ogfr UTSW 2 180,237,221 (GRCm39) missense possibly damaging 0.70
R7111:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R7201:Ogfr UTSW 2 180,236,887 (GRCm39) unclassified probably benign
R7217:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R7243:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R7387:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R7563:Ogfr UTSW 2 180,234,300 (GRCm39) critical splice donor site probably null
R7681:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R7844:Ogfr UTSW 2 180,236,850 (GRCm39) unclassified probably benign
R7845:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R7848:Ogfr UTSW 2 180,234,226 (GRCm39) missense probably damaging 1.00
R7930:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R7985:Ogfr UTSW 2 180,236,850 (GRCm39) unclassified probably benign
R8011:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R8039:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R8045:Ogfr UTSW 2 180,236,850 (GRCm39) unclassified probably benign
R8094:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R8339:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R8464:Ogfr UTSW 2 180,236,850 (GRCm39) unclassified probably benign
R8555:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R8557:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R8688:Ogfr UTSW 2 180,236,850 (GRCm39) unclassified probably benign
R8703:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R8856:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R8886:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R8956:Ogfr UTSW 2 180,236,850 (GRCm39) unclassified probably benign
R9098:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R9198:Ogfr UTSW 2 180,232,850 (GRCm39) critical splice donor site probably null
R9227:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R9244:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R9340:Ogfr UTSW 2 180,236,850 (GRCm39) unclassified probably benign
R9352:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R9462:Ogfr UTSW 2 180,236,850 (GRCm39) unclassified probably benign
R9514:Ogfr UTSW 2 180,235,417 (GRCm39) missense possibly damaging 0.61
R9612:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
R9661:Ogfr UTSW 2 180,233,431 (GRCm39) missense probably damaging 1.00
R9782:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
RF022:Ogfr UTSW 2 180,237,059 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGAACAGCCCTGTCTTGTGG -3'
(R):5'- TTAGAGGCAGCTTGCTCTG -3'

Sequencing Primer
(F):5'- CAGCCCTGTCTTGTGGCTAGG -3'
(R):5'- CTCCACCTGGCTTTTGGGG -3'
Posted On 2022-06-15