Incidental Mutation 'R9440:Mybphl'
ID 713571
Institutional Source Beutler Lab
Gene Symbol Mybphl
Ensembl Gene ENSMUSG00000068745
Gene Name myosin binding protein H-like
Synonyms 1110037P11Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R9440 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 108272227-108287373 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108282202 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 144 (I144T)
Ref Sequence ENSEMBL: ENSMUSP00000088051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090563]
AlphaFold Q5FW53
Predicted Effect probably benign
Transcript: ENSMUST00000090563
AA Change: I144T

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000088051
Gene: ENSMUSG00000068745
AA Change: I144T

DomainStartEndE-ValueType
IG 61 144 4.67e-4 SMART
FN3 147 229 1.62e-10 SMART
IG 268 352 3.68e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two immunoglobulin superfamily domains and a fibronectin 3 domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,499,452 (GRCm39) T1359M probably benign Het
Acacb T A 5: 114,384,085 (GRCm39) C2205S possibly damaging Het
Akap3 A G 6: 126,841,591 (GRCm39) E70G probably benign Het
Aldh1a3 C A 7: 66,068,992 (GRCm39) probably null Het
Asb4 A G 6: 5,429,817 (GRCm39) I352M probably benign Het
Bach1 C G 16: 87,516,603 (GRCm39) S381R probably benign Het
BC034090 A G 1: 155,101,961 (GRCm39) L101P probably benign Het
Bms1 A T 6: 118,382,217 (GRCm39) D440E probably benign Het
Bpifb6 A T 2: 153,747,914 (GRCm39) D191V probably benign Het
Cfap298 A T 16: 90,726,832 (GRCm39) V116E probably benign Het
Cfd T C 10: 79,726,816 (GRCm39) probably null Het
Cnot3 G A 7: 3,656,560 (GRCm39) E252K probably damaging Het
Col6a3 T C 1: 90,707,068 (GRCm39) D2622G unknown Het
Crybg2 T C 4: 133,801,602 (GRCm39) S612P probably benign Het
Cyp4b1 T C 4: 115,493,581 (GRCm39) K167R probably damaging Het
Gbp3 T C 3: 142,272,335 (GRCm39) V279A possibly damaging Het
Gipc2 T C 3: 151,833,706 (GRCm39) T192A possibly damaging Het
Gm3285 T C 10: 77,697,911 (GRCm39) V20A Het
Gorasp2 T C 2: 70,541,469 (GRCm39) probably null Het
Gpr179 A G 11: 97,229,315 (GRCm39) S947P probably benign Het
Klra5 C A 6: 129,883,686 (GRCm39) W147L possibly damaging Het
Lrch4 G A 5: 137,636,051 (GRCm39) R368Q probably damaging Het
Mamdc4 A G 2: 25,455,600 (GRCm39) V876A probably benign Het
Marf1 A C 16: 13,938,196 (GRCm39) D1433E probably benign Het
Mcm4 A T 16: 15,453,175 (GRCm39) C171* probably null Het
Micall1 C T 15: 79,011,159 (GRCm39) P510S Het
Morc3 A G 16: 93,649,975 (GRCm39) probably null Het
Mrpl28 G T 17: 26,345,266 (GRCm39) V229F possibly damaging Het
Mrps33 A T 6: 39,782,364 (GRCm39) Y52* probably null Het
Myom1 A G 17: 71,433,329 (GRCm39) M1657V probably benign Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,236,850 (GRCm39) probably benign Het
Or5p67 A G 7: 107,922,037 (GRCm39) I282T probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Plxna1 T C 6: 89,318,912 (GRCm39) K637R probably benign Het
Prob1 G T 18: 35,786,218 (GRCm39) L679I possibly damaging Het
Sgms2 C A 3: 131,118,718 (GRCm39) C255F probably damaging Het
Slc17a9 T C 2: 180,383,090 (GRCm39) C399R probably benign Het
Smc4 T A 3: 68,915,455 (GRCm39) probably null Het
St14 A G 9: 31,007,845 (GRCm39) L578P probably damaging Het
Tcaf3 A T 6: 42,573,906 (GRCm39) L102* probably null Het
Tex15 A G 8: 34,072,273 (GRCm39) T2607A possibly damaging Het
Trav15-2-dv6-2 T A 14: 53,886,932 (GRCm39) probably benign Het
Trip4 T C 9: 65,760,234 (GRCm39) probably null Het
Ttf1 A G 2: 28,955,709 (GRCm39) I358V probably benign Het
Uroc1 C A 6: 90,322,353 (GRCm39) S292R possibly damaging Het
Vmn1r5 T C 6: 56,962,415 (GRCm39) I30T possibly damaging Het
Vps33a A T 5: 123,703,047 (GRCm39) I192N probably damaging Het
Vps50 A G 6: 3,516,724 (GRCm39) I69V probably benign Het
Wdr97 T C 15: 76,245,064 (GRCm39) S1176P Het
Xirp1 G A 9: 119,847,203 (GRCm39) T560M probably damaging Het
Zfp512 A T 5: 31,628,359 (GRCm39) T266S possibly damaging Het
Other mutations in Mybphl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03365:Mybphl APN 3 108,272,314 (GRCm39) start codon destroyed probably null 0.98
IGL03389:Mybphl APN 3 108,283,034 (GRCm39) missense probably benign 0.09
R0194:Mybphl UTSW 3 108,281,484 (GRCm39) missense probably benign 0.01
R0206:Mybphl UTSW 3 108,282,731 (GRCm39) missense probably damaging 1.00
R0206:Mybphl UTSW 3 108,282,731 (GRCm39) missense probably damaging 1.00
R0208:Mybphl UTSW 3 108,282,731 (GRCm39) missense probably damaging 1.00
R1067:Mybphl UTSW 3 108,272,319 (GRCm39) missense probably benign
R1223:Mybphl UTSW 3 108,282,512 (GRCm39) missense possibly damaging 0.81
R1748:Mybphl UTSW 3 108,282,400 (GRCm39) critical splice acceptor site probably null
R2013:Mybphl UTSW 3 108,282,718 (GRCm39) missense probably benign 0.02
R2102:Mybphl UTSW 3 108,282,949 (GRCm39) missense possibly damaging 0.82
R2121:Mybphl UTSW 3 108,282,492 (GRCm39) missense probably damaging 1.00
R2197:Mybphl UTSW 3 108,284,635 (GRCm39) missense probably damaging 1.00
R2265:Mybphl UTSW 3 108,272,317 (GRCm39) missense probably damaging 1.00
R2266:Mybphl UTSW 3 108,272,317 (GRCm39) missense probably damaging 1.00
R2267:Mybphl UTSW 3 108,272,317 (GRCm39) missense probably damaging 1.00
R2268:Mybphl UTSW 3 108,272,317 (GRCm39) missense probably damaging 1.00
R4551:Mybphl UTSW 3 108,281,479 (GRCm39) missense possibly damaging 0.49
R4570:Mybphl UTSW 3 108,272,347 (GRCm39) missense possibly damaging 0.61
R4693:Mybphl UTSW 3 108,282,494 (GRCm39) missense probably benign 0.01
R5759:Mybphl UTSW 3 108,282,070 (GRCm39) missense probably benign 0.30
R7017:Mybphl UTSW 3 108,282,154 (GRCm39) missense probably damaging 0.99
R7526:Mybphl UTSW 3 108,281,496 (GRCm39) missense probably benign 0.00
R8266:Mybphl UTSW 3 108,284,676 (GRCm39) missense probably damaging 1.00
R8976:Mybphl UTSW 3 108,272,334 (GRCm39) missense probably damaging 1.00
R9617:Mybphl UTSW 3 108,282,952 (GRCm39) missense possibly damaging 0.68
R9655:Mybphl UTSW 3 108,282,099 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACCTGGACTCACAATGG -3'
(R):5'- ACCAACTTAATACTCTGAGGAGGG -3'

Sequencing Primer
(F):5'- GGCTGTGCCCTGGACAG -3'
(R):5'- TTCTCTGGAAGAGCAAAGCC -3'
Posted On 2022-06-15