Incidental Mutation 'R9440:Tcaf3'
ID 713585
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R9440 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 42584866-42597692 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 42596972 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 102 (L102*)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect probably null
Transcript: ENSMUST00000069023
AA Change: L102*
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: L102*

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably null
Transcript: ENSMUST00000134707
AA Change: L102*
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656
AA Change: L102*

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik A T 16: 90,929,944 V116E probably benign Het
Abca17 G A 17: 24,280,478 T1359M probably benign Het
Acacb T A 5: 114,246,024 C2205S possibly damaging Het
Akap3 A G 6: 126,864,628 E70G probably benign Het
Aldh1a3 C A 7: 66,419,244 probably null Het
Asb4 A G 6: 5,429,817 I352M probably benign Het
Bach1 C G 16: 87,719,715 S381R probably benign Het
BC034090 A G 1: 155,226,215 L101P probably benign Het
Bms1 A T 6: 118,405,256 D440E probably benign Het
Bpifb6 A T 2: 153,905,994 D191V probably benign Het
Cfd T C 10: 79,890,982 probably null Het
Cnot3 G A 7: 3,653,561 E252K probably damaging Het
Col6a3 T C 1: 90,779,346 D2622G unknown Het
Crybg2 T C 4: 134,074,291 S612P probably benign Het
Cyp4b1 T C 4: 115,636,384 K167R probably damaging Het
Gbp3 T C 3: 142,566,574 V279A possibly damaging Het
Gipc2 T C 3: 152,128,069 T192A possibly damaging Het
Gm3285 T C 10: 77,862,077 V20A Het
Gm35339 T C 15: 76,360,864 S1176P Het
Gorasp2 T C 2: 70,711,125 probably null Het
Gpr179 A G 11: 97,338,489 S947P probably benign Het
Klra5 C A 6: 129,906,723 W147L possibly damaging Het
Lrch4 G A 5: 137,637,789 R368Q probably damaging Het
Mamdc4 A G 2: 25,565,588 V876A probably benign Het
Marf1 A C 16: 14,120,332 D1433E probably benign Het
Mcm4 A T 16: 15,635,311 C171* probably null Het
Micall1 C T 15: 79,126,959 P510S Het
Morc3 A G 16: 93,853,087 probably null Het
Mrpl28 G T 17: 26,126,292 V229F possibly damaging Het
Mrps33 A T 6: 39,805,430 Y52* probably null Het
Mybphl T C 3: 108,374,886 I144T probably benign Het
Myom1 A G 17: 71,126,334 M1657V probably benign Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr492 A G 7: 108,322,830 I282T probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Plxna1 T C 6: 89,341,930 K637R probably benign Het
Prob1 G T 18: 35,653,165 L679I possibly damaging Het
Sgms2 C A 3: 131,325,069 C255F probably damaging Het
Slc17a9 T C 2: 180,741,297 C399R probably benign Het
Smc4 T A 3: 69,008,122 probably null Het
St14 A G 9: 31,096,549 L578P probably damaging Het
Tex15 A G 8: 33,582,245 T2607A possibly damaging Het
Trav15-2-dv6-2 T A 14: 53,649,475 probably benign Het
Trip4 T C 9: 65,852,952 probably null Het
Ttf1 A G 2: 29,065,697 I358V probably benign Het
Uroc1 C A 6: 90,345,371 S292R possibly damaging Het
Vmn1r5 T C 6: 56,985,430 I30T possibly damaging Het
Vps33a A T 5: 123,564,984 I192N probably damaging Het
Vps50 A G 6: 3,516,724 I69V probably benign Het
Xirp1 G A 9: 120,018,137 T560M probably damaging Het
Zfp512 A T 5: 31,471,015 T266S possibly damaging Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42593385 missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42597228 missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42593681 missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42597129 missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42596660 missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42593898 missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42589839 missense probably damaging 1.00
defused UTSW 6 42596933 missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42591350 missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42589758 missense probably benign
R0357:Tcaf3 UTSW 6 42589827 missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42596843 missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42593552 missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42596688 missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42593724 missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42593328 missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42591430 missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42593729 missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42594044 missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42593853 missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42597080 missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42589996 missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42587579 missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42593366 splice site probably null
R4904:Tcaf3 UTSW 6 42593997 nonsense probably null
R5030:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42593684 missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42591325 missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42597020 missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42593715 missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42591467 missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42587510 missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42591926 missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42596763 missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42597185 missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42587528 missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42593849 missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42596697 missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42589971 missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42593791 missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42597259 missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42597171 missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42593238 missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42594061 missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42597125 missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42593891 missense probably benign
R7185:Tcaf3 UTSW 6 42593930 missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42593801 missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42589914 missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42596842 missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42597135 missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42594206 splice site probably null
R7909:Tcaf3 UTSW 6 42591964 missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42596782 missense probably benign 0.00
R9469:Tcaf3 UTSW 6 42596894 missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42589702 missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42597090 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATAGCACTTTATCATGGCCATGG -3'
(R):5'- AGTCAGCCTTCCCAGTGATG -3'

Sequencing Primer
(F):5'- ATGGTGAGCAGCCCAATTC -3'
(R):5'- CCTTCCCAGTGATGGTGAATGAC -3'
Posted On 2022-06-15