Incidental Mutation 'R9440:1110004E09Rik'
ID 713608
Institutional Source Beutler Lab
Gene Symbol 1110004E09Rik
Ensembl Gene ENSMUSG00000022972
Gene Name RIKEN cDNA 1110004E09 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock # R9440 (G1)
Quality Score 183.009
Status Not validated
Chromosome 16
Chromosomal Location 90925809-90935114 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 90929944 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 116 (V116E)
Ref Sequence ENSEMBL: ENSMUSP00000023694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023694] [ENSMUST00000125519] [ENSMUST00000142340] [ENSMUST00000149833]
AlphaFold Q8BL95
Predicted Effect probably benign
Transcript: ENSMUST00000023694
AA Change: V116E

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023694
Gene: ENSMUSG00000022972
AA Change: V116E

DomainStartEndE-ValueType
Pfam:DUF2870 189 285 4.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125519
Predicted Effect
SMART Domains Protein: ENSMUSP00000122163
Gene: ENSMUSG00000022972
AA Change: V13E

DomainStartEndE-ValueType
Pfam:DUF2870 87 122 6.2e-17 PFAM
Pfam:DUF2870 118 151 4.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142340
AA Change: V72E

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000149833
AA Change: V99E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000123417
Gene: ENSMUSG00000022972
AA Change: V99E

DomainStartEndE-ValueType
Pfam:DUF2870 171 198 5.8e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene a protein plays a critical role in dynein arm assembly and motile cilia function. Mutations in this gene result in primary ciliary dyskinesia. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,280,478 T1359M probably benign Het
Acacb T A 5: 114,246,024 C2205S possibly damaging Het
Akap3 A G 6: 126,864,628 E70G probably benign Het
Aldh1a3 C A 7: 66,419,244 probably null Het
Asb4 A G 6: 5,429,817 I352M probably benign Het
Bach1 C G 16: 87,719,715 S381R probably benign Het
BC034090 A G 1: 155,226,215 L101P probably benign Het
Bms1 A T 6: 118,405,256 D440E probably benign Het
Bpifb6 A T 2: 153,905,994 D191V probably benign Het
Cfd T C 10: 79,890,982 probably null Het
Cnot3 G A 7: 3,653,561 E252K probably damaging Het
Col6a3 T C 1: 90,779,346 D2622G unknown Het
Crybg2 T C 4: 134,074,291 S612P probably benign Het
Cyp4b1 T C 4: 115,636,384 K167R probably damaging Het
Gbp3 T C 3: 142,566,574 V279A possibly damaging Het
Gipc2 T C 3: 152,128,069 T192A possibly damaging Het
Gm3285 T C 10: 77,862,077 V20A Het
Gm35339 T C 15: 76,360,864 S1176P Het
Gorasp2 T C 2: 70,711,125 probably null Het
Gpr179 A G 11: 97,338,489 S947P probably benign Het
Klra5 C A 6: 129,906,723 W147L possibly damaging Het
Lrch4 G A 5: 137,637,789 R368Q probably damaging Het
Mamdc4 A G 2: 25,565,588 V876A probably benign Het
Marf1 A C 16: 14,120,332 D1433E probably benign Het
Mcm4 A T 16: 15,635,311 C171* probably null Het
Micall1 C T 15: 79,126,959 P510S Het
Morc3 A G 16: 93,853,087 probably null Het
Mrpl28 G T 17: 26,126,292 V229F possibly damaging Het
Mrps33 A T 6: 39,805,430 Y52* probably null Het
Mybphl T C 3: 108,374,886 I144T probably benign Het
Myom1 A G 17: 71,126,334 M1657V probably benign Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr492 A G 7: 108,322,830 I282T probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Plxna1 T C 6: 89,341,930 K637R probably benign Het
Prob1 G T 18: 35,653,165 L679I possibly damaging Het
Sgms2 C A 3: 131,325,069 C255F probably damaging Het
Slc17a9 T C 2: 180,741,297 C399R probably benign Het
Smc4 T A 3: 69,008,122 probably null Het
St14 A G 9: 31,096,549 L578P probably damaging Het
Tcaf3 A T 6: 42,596,972 L102* probably null Het
Tex15 A G 8: 33,582,245 T2607A possibly damaging Het
Trav15-2-dv6-2 T A 14: 53,649,475 probably benign Het
Trip4 T C 9: 65,852,952 probably null Het
Ttf1 A G 2: 29,065,697 I358V probably benign Het
Uroc1 C A 6: 90,345,371 S292R possibly damaging Het
Vmn1r5 T C 6: 56,985,430 I30T possibly damaging Het
Vps33a A T 5: 123,564,984 I192N probably damaging Het
Vps50 A G 6: 3,516,724 I69V probably benign Het
Xirp1 G A 9: 120,018,137 T560M probably damaging Het
Zfp512 A T 5: 31,471,015 T266S possibly damaging Het
Other mutations in 1110004E09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:1110004E09Rik APN 16 90926048 missense possibly damaging 0.60
IGL02607:1110004E09Rik APN 16 90929947 missense probably damaging 1.00
IGL02826:1110004E09Rik APN 16 90926062 missense probably benign 0.02
R0920:1110004E09Rik UTSW 16 90927379 missense probably damaging 0.98
R4586:1110004E09Rik UTSW 16 90927426 missense probably damaging 1.00
R5415:1110004E09Rik UTSW 16 90926065 missense probably benign 0.05
R5443:1110004E09Rik UTSW 16 90927211 missense probably benign
R8114:1110004E09Rik UTSW 16 90934657 missense probably benign
R8191:1110004E09Rik UTSW 16 90931001 missense probably damaging 0.99
R8699:1110004E09Rik UTSW 16 90931057 missense probably benign 0.03
R8876:1110004E09Rik UTSW 16 90927393 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GGTAACTGTCATCACCGTTATGC -3'
(R):5'- TCCCTGTGTCAAATCCAGAC -3'

Sequencing Primer
(F):5'- CTTTGCTACTGGAAGGCAGAG -3'
(R):5'- GACTGGAACACCCATGTCTCG -3'
Posted On 2022-06-15