Incidental Mutation 'R9440:Myom1'
ID 713612
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Name myomesin 1
Synonyms skelemin, D430047A17Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9440 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 71326455-71433851 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71433329 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 1657 (M1657V)
Ref Sequence ENSEMBL: ENSMUSP00000072945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
AlphaFold Q62234
PDB Structure Skelemin Immunoglobulin C2 like domain 4 [SOLUTION NMR]
Skelemin Association with alfa2b,betta3 Integrin: A Structural Model [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000024847
AA Change: M1559V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: M1559V

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073211
AA Change: M1657V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: M1657V

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179759
AA Change: M1559V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: M1559V

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,499,452 (GRCm39) T1359M probably benign Het
Acacb T A 5: 114,384,085 (GRCm39) C2205S possibly damaging Het
Akap3 A G 6: 126,841,591 (GRCm39) E70G probably benign Het
Aldh1a3 C A 7: 66,068,992 (GRCm39) probably null Het
Asb4 A G 6: 5,429,817 (GRCm39) I352M probably benign Het
Bach1 C G 16: 87,516,603 (GRCm39) S381R probably benign Het
BC034090 A G 1: 155,101,961 (GRCm39) L101P probably benign Het
Bms1 A T 6: 118,382,217 (GRCm39) D440E probably benign Het
Bpifb6 A T 2: 153,747,914 (GRCm39) D191V probably benign Het
Cfap298 A T 16: 90,726,832 (GRCm39) V116E probably benign Het
Cfd T C 10: 79,726,816 (GRCm39) probably null Het
Cnot3 G A 7: 3,656,560 (GRCm39) E252K probably damaging Het
Col6a3 T C 1: 90,707,068 (GRCm39) D2622G unknown Het
Crybg2 T C 4: 133,801,602 (GRCm39) S612P probably benign Het
Cyp4b1 T C 4: 115,493,581 (GRCm39) K167R probably damaging Het
Gbp3 T C 3: 142,272,335 (GRCm39) V279A possibly damaging Het
Gipc2 T C 3: 151,833,706 (GRCm39) T192A possibly damaging Het
Gm3285 T C 10: 77,697,911 (GRCm39) V20A Het
Gorasp2 T C 2: 70,541,469 (GRCm39) probably null Het
Gpr179 A G 11: 97,229,315 (GRCm39) S947P probably benign Het
Klra5 C A 6: 129,883,686 (GRCm39) W147L possibly damaging Het
Lrch4 G A 5: 137,636,051 (GRCm39) R368Q probably damaging Het
Mamdc4 A G 2: 25,455,600 (GRCm39) V876A probably benign Het
Marf1 A C 16: 13,938,196 (GRCm39) D1433E probably benign Het
Mcm4 A T 16: 15,453,175 (GRCm39) C171* probably null Het
Micall1 C T 15: 79,011,159 (GRCm39) P510S Het
Morc3 A G 16: 93,649,975 (GRCm39) probably null Het
Mrpl28 G T 17: 26,345,266 (GRCm39) V229F possibly damaging Het
Mrps33 A T 6: 39,782,364 (GRCm39) Y52* probably null Het
Mybphl T C 3: 108,282,202 (GRCm39) I144T probably benign Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,236,850 (GRCm39) probably benign Het
Or5p67 A G 7: 107,922,037 (GRCm39) I282T probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Plxna1 T C 6: 89,318,912 (GRCm39) K637R probably benign Het
Prob1 G T 18: 35,786,218 (GRCm39) L679I possibly damaging Het
Sgms2 C A 3: 131,118,718 (GRCm39) C255F probably damaging Het
Slc17a9 T C 2: 180,383,090 (GRCm39) C399R probably benign Het
Smc4 T A 3: 68,915,455 (GRCm39) probably null Het
St14 A G 9: 31,007,845 (GRCm39) L578P probably damaging Het
Tcaf3 A T 6: 42,573,906 (GRCm39) L102* probably null Het
Tex15 A G 8: 34,072,273 (GRCm39) T2607A possibly damaging Het
Trav15-2-dv6-2 T A 14: 53,886,932 (GRCm39) probably benign Het
Trip4 T C 9: 65,760,234 (GRCm39) probably null Het
Ttf1 A G 2: 28,955,709 (GRCm39) I358V probably benign Het
Uroc1 C A 6: 90,322,353 (GRCm39) S292R possibly damaging Het
Vmn1r5 T C 6: 56,962,415 (GRCm39) I30T possibly damaging Het
Vps33a A T 5: 123,703,047 (GRCm39) I192N probably damaging Het
Vps50 A G 6: 3,516,724 (GRCm39) I69V probably benign Het
Wdr97 T C 15: 76,245,064 (GRCm39) S1176P Het
Xirp1 G A 9: 119,847,203 (GRCm39) T560M probably damaging Het
Zfp512 A T 5: 31,628,359 (GRCm39) T266S possibly damaging Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71,433,093 (GRCm39) missense probably damaging 1.00
IGL00845:Myom1 APN 17 71,391,424 (GRCm39) missense probably damaging 1.00
IGL00904:Myom1 APN 17 71,406,944 (GRCm39) splice site probably benign
IGL00928:Myom1 APN 17 71,396,908 (GRCm39) missense probably damaging 1.00
IGL01025:Myom1 APN 17 71,384,912 (GRCm39) missense probably damaging 1.00
IGL01548:Myom1 APN 17 71,408,215 (GRCm39) splice site probably benign
IGL01588:Myom1 APN 17 71,424,432 (GRCm39) missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71,433,173 (GRCm39) missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71,406,988 (GRCm39) missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71,351,471 (GRCm39) splice site probably benign
IGL01766:Myom1 APN 17 71,384,283 (GRCm39) missense probably damaging 1.00
IGL02105:Myom1 APN 17 71,354,711 (GRCm39) splice site probably benign
IGL02122:Myom1 APN 17 71,399,132 (GRCm39) missense probably damaging 1.00
IGL02184:Myom1 APN 17 71,379,132 (GRCm39) missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71,415,310 (GRCm39) nonsense probably null
IGL02486:Myom1 APN 17 71,406,939 (GRCm39) splice site probably benign
IGL02501:Myom1 APN 17 71,379,076 (GRCm39) critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71,408,093 (GRCm39) missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71,391,344 (GRCm39) missense probably damaging 1.00
IGL02719:Myom1 APN 17 71,413,349 (GRCm39) splice site probably benign
IGL02945:Myom1 APN 17 71,399,088 (GRCm39) splice site probably benign
IGL03086:Myom1 APN 17 71,415,666 (GRCm39) missense probably damaging 1.00
IGL03218:Myom1 APN 17 71,391,311 (GRCm39) missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71,384,360 (GRCm39) missense probably damaging 1.00
R0130:Myom1 UTSW 17 71,352,750 (GRCm39) missense probably damaging 0.98
R0133:Myom1 UTSW 17 71,354,782 (GRCm39) missense probably damaging 1.00
R0206:Myom1 UTSW 17 71,344,292 (GRCm39) missense probably damaging 1.00
R0206:Myom1 UTSW 17 71,344,292 (GRCm39) missense probably damaging 1.00
R0352:Myom1 UTSW 17 71,352,744 (GRCm39) missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71,341,688 (GRCm39) missense probably damaging 1.00
R0496:Myom1 UTSW 17 71,391,301 (GRCm39) missense probably damaging 1.00
R0506:Myom1 UTSW 17 71,399,215 (GRCm39) splice site probably benign
R0511:Myom1 UTSW 17 71,391,312 (GRCm39) missense probably benign 0.22
R0600:Myom1 UTSW 17 71,427,643 (GRCm39) missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71,374,308 (GRCm39) missense probably damaging 0.98
R0791:Myom1 UTSW 17 71,428,131 (GRCm39) missense probably damaging 1.00
R0792:Myom1 UTSW 17 71,428,131 (GRCm39) missense probably damaging 1.00
R0963:Myom1 UTSW 17 71,384,762 (GRCm39) missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71,359,714 (GRCm39) missense probably damaging 0.98
R2102:Myom1 UTSW 17 71,408,024 (GRCm39) missense probably damaging 1.00
R2158:Myom1 UTSW 17 71,371,592 (GRCm39) missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71,330,189 (GRCm39) missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71,341,574 (GRCm39) missense probably damaging 0.98
R2442:Myom1 UTSW 17 71,417,730 (GRCm39) missense probably damaging 1.00
R2483:Myom1 UTSW 17 71,384,807 (GRCm39) missense probably damaging 1.00
R2892:Myom1 UTSW 17 71,341,648 (GRCm39) missense probably damaging 1.00
R2897:Myom1 UTSW 17 71,408,215 (GRCm39) splice site probably benign
R3440:Myom1 UTSW 17 71,352,658 (GRCm39) splice site probably null
R3842:Myom1 UTSW 17 71,352,619 (GRCm39) missense probably damaging 1.00
R4249:Myom1 UTSW 17 71,399,135 (GRCm39) missense probably damaging 1.00
R4329:Myom1 UTSW 17 71,343,348 (GRCm39) missense probably damaging 1.00
R4594:Myom1 UTSW 17 71,407,069 (GRCm39) missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71,379,114 (GRCm39) missense probably damaging 1.00
R4875:Myom1 UTSW 17 71,379,114 (GRCm39) missense probably damaging 1.00
R4876:Myom1 UTSW 17 71,384,405 (GRCm39) missense probably damaging 1.00
R5171:Myom1 UTSW 17 71,406,967 (GRCm39) missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71,416,782 (GRCm39) missense probably damaging 1.00
R5882:Myom1 UTSW 17 71,417,717 (GRCm39) missense probably damaging 1.00
R5978:Myom1 UTSW 17 71,424,438 (GRCm39) missense probably damaging 1.00
R6039:Myom1 UTSW 17 71,417,746 (GRCm39) missense probably damaging 1.00
R6039:Myom1 UTSW 17 71,417,746 (GRCm39) missense probably damaging 1.00
R6155:Myom1 UTSW 17 71,415,690 (GRCm39) critical splice donor site probably null
R6261:Myom1 UTSW 17 71,433,132 (GRCm39) missense probably damaging 1.00
R6284:Myom1 UTSW 17 71,329,887 (GRCm39) nonsense probably null
R6313:Myom1 UTSW 17 71,389,483 (GRCm39) missense probably benign
R6369:Myom1 UTSW 17 71,408,071 (GRCm39) missense probably damaging 1.00
R6545:Myom1 UTSW 17 71,389,300 (GRCm39) missense probably benign 0.00
R6738:Myom1 UTSW 17 71,407,393 (GRCm39) splice site probably null
R6933:Myom1 UTSW 17 71,359,666 (GRCm39) missense probably damaging 1.00
R7168:Myom1 UTSW 17 71,396,942 (GRCm39) missense probably benign 0.00
R7286:Myom1 UTSW 17 71,352,544 (GRCm39) missense possibly damaging 0.90
R7315:Myom1 UTSW 17 71,387,892 (GRCm39) critical splice donor site probably null
R7672:Myom1 UTSW 17 71,391,235 (GRCm39) missense possibly damaging 0.92
R7789:Myom1 UTSW 17 71,424,431 (GRCm39) missense probably benign 0.03
R7898:Myom1 UTSW 17 71,352,747 (GRCm39) missense probably benign 0.25
R8008:Myom1 UTSW 17 71,407,057 (GRCm39) missense probably benign 0.30
R8152:Myom1 UTSW 17 71,391,290 (GRCm39) missense probably damaging 0.96
R8554:Myom1 UTSW 17 71,343,448 (GRCm39) missense possibly damaging 0.94
R8874:Myom1 UTSW 17 71,413,199 (GRCm39) missense probably damaging 1.00
R8981:Myom1 UTSW 17 71,391,316 (GRCm39) missense probably benign 0.09
R9012:Myom1 UTSW 17 71,407,103 (GRCm39) missense probably benign 0.06
R9090:Myom1 UTSW 17 71,374,325 (GRCm39) missense probably damaging 1.00
R9193:Myom1 UTSW 17 71,343,295 (GRCm39) missense probably damaging 1.00
R9237:Myom1 UTSW 17 71,408,051 (GRCm39) missense probably damaging 1.00
R9271:Myom1 UTSW 17 71,374,325 (GRCm39) missense probably damaging 1.00
R9355:Myom1 UTSW 17 71,384,888 (GRCm39) missense probably damaging 1.00
R9362:Myom1 UTSW 17 71,343,288 (GRCm39) missense probably benign 0.00
R9469:Myom1 UTSW 17 71,368,122 (GRCm39) missense possibly damaging 0.79
R9568:Myom1 UTSW 17 71,394,476 (GRCm39) missense probably damaging 1.00
R9612:Myom1 UTSW 17 71,412,475 (GRCm39) nonsense probably null
R9645:Myom1 UTSW 17 71,399,204 (GRCm39) missense probably benign 0.01
X0019:Myom1 UTSW 17 71,407,066 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AGAAGCCACTGACCTCTGAC -3'
(R):5'- CAATGGTGCCTCCTCATCTATAG -3'

Sequencing Primer
(F):5'- TGACCTCTGACGACCACTG -3'
(R):5'- GGTGCCTCCTCATCTATAGGAATAAG -3'
Posted On 2022-06-15