Incidental Mutation 'R9441:Col6a3'
ID 713618
Institutional Source Beutler Lab
Gene Symbol Col6a3
Ensembl Gene ENSMUSG00000048126
Gene Name collagen, type VI, alpha 3
Synonyms Col6a-3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9441 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 90694582-90771710 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 90705249 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 2824 (Y2824*)
Ref Sequence ENSEMBL: ENSMUSP00000057131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000188587]
AlphaFold no structure available at present
PDB Structure Crystal structure of the Collagen VI alpha3 N5 domain [X-RAY DIFFRACTION]
Crystal structure of the Collagen VI alpha3 N5 domain R1061Q [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000056925
AA Change: Y2824*
SMART Domains Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: Y2824*

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
VWA 1634 1807 1.78e-37 SMART
VWA 1833 2022 7.92e-3 SMART
Pfam:Collagen 2033 2094 2e-10 PFAM
Pfam:Collagen 2077 2142 2.8e-10 PFAM
low complexity region 2179 2222 N/A INTRINSIC
low complexity region 2228 2279 N/A INTRINSIC
Pfam:Collagen 2311 2373 7.9e-11 PFAM
VWA 2397 2576 3.95e-21 SMART
VWA 2614 2813 2.25e-25 SMART
low complexity region 2864 2880 N/A INTRINSIC
low complexity region 2886 2900 N/A INTRINSIC
low complexity region 2903 2941 N/A INTRINSIC
low complexity region 2945 3024 N/A INTRINSIC
low complexity region 3039 3076 N/A INTRINSIC
low complexity region 3091 3103 N/A INTRINSIC
FN3 3104 3183 4.6e-1 SMART
KU 3226 3279 4.34e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000097653
AA Change: Y2217*
SMART Domains Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126
AA Change: Y2217*

DomainStartEndE-ValueType
VWA 35 210 7.27e-43 SMART
VWA 227 403 4.21e-39 SMART
VWA 417 596 3.02e-40 SMART
VWA 621 799 1.1e-42 SMART
VWA 824 997 9.17e-40 SMART
VWA 1027 1200 1.78e-37 SMART
VWA 1226 1415 7.92e-3 SMART
Pfam:Collagen 1426 1486 9.2e-10 PFAM
Pfam:Collagen 1473 1539 2.2e-9 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 3.95e-21 SMART
VWA 2007 2206 2.25e-25 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 4.6e-1 SMART
KU 2619 2672 4.34e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188587
AA Change: Y2217*
SMART Domains Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126
AA Change: Y2217*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 35 210 4.7e-45 SMART
VWA 227 403 2.7e-41 SMART
VWA 417 596 2e-42 SMART
VWA 621 799 7e-45 SMART
VWA 824 997 5.8e-42 SMART
VWA 1027 1200 1.1e-39 SMART
VWA 1226 1415 4.8e-5 SMART
Pfam:Collagen 1426 1486 3.8e-8 PFAM
Pfam:Collagen 1473 1539 9.1e-8 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 2.4e-23 SMART
VWA 2007 2206 1.4e-27 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 2.2e-3 SMART
KU 2619 2672 2.1e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik C A 9: 55,917,776 (GRCm39) G20V unknown Het
Adam22 T C 5: 8,161,974 (GRCm39) T733A possibly damaging Het
Adam28 T A 14: 68,874,943 (GRCm39) N245Y probably damaging Het
Aldh9a1 C G 1: 167,177,919 (GRCm39) R39G probably benign Het
Armc3 A C 2: 19,253,426 (GRCm39) E189A possibly damaging Het
Atg9a C T 1: 75,163,086 (GRCm39) C338Y possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,128,173 (GRCm39) probably benign Het
Cars1 G A 7: 143,123,185 (GRCm39) T560I probably benign Het
Casp8ap2 A G 4: 32,645,873 (GRCm39) K1649E probably benign Het
Ccdc88b T C 19: 6,833,213 (GRCm39) E278G probably damaging Het
Cd84 G A 1: 171,713,994 (GRCm39) probably null Het
Ces2g G T 8: 105,690,623 (GRCm39) A135S possibly damaging Het
Cfh T C 1: 140,030,149 (GRCm39) D926G probably benign Het
Chrm2 A G 6: 36,500,955 (GRCm39) T271A probably benign Het
Cth T A 3: 157,616,575 (GRCm39) R196S probably damaging Het
Cyp2g1 T C 7: 26,514,060 (GRCm39) M222T possibly damaging Het
Depdc5 T A 5: 33,095,042 (GRCm39) M773K probably benign Het
Dmbx1 G A 4: 115,780,884 (GRCm39) P39L probably damaging Het
Dst G C 1: 34,238,432 (GRCm39) W1697C probably damaging Het
Eno1 C T 4: 150,321,208 (GRCm39) probably benign Het
Erc2 G T 14: 27,802,114 (GRCm39) V761L possibly damaging Het
Frem1 A T 4: 82,924,083 (GRCm39) I292N probably damaging Het
Ftdc2 G A 16: 58,458,884 (GRCm39) probably benign Het
Hip1 G T 5: 135,460,571 (GRCm39) L530M possibly damaging Het
Kcna2 A G 3: 107,012,268 (GRCm39) Q283R probably benign Het
Kndc1 G A 7: 139,501,392 (GRCm39) D894N probably damaging Het
Lats1 G T 10: 7,578,681 (GRCm39) G602W probably damaging Het
Lgals12 A G 19: 7,581,356 (GRCm39) L117P probably damaging Het
Mfsd4b1 A T 10: 39,878,680 (GRCm39) L406I possibly damaging Het
Msln A T 17: 25,969,731 (GRCm39) M333K probably benign Het
Mup2 A G 4: 60,139,740 (GRCm39) V16A probably benign Het
Mybpc2 T C 7: 44,166,330 (GRCm39) E220G probably null Het
Myh6 A G 14: 55,197,771 (GRCm39) Y456H probably benign Het
Nlrp1a A G 11: 71,013,934 (GRCm39) S439P probably damaging Het
Nyap1 T C 5: 137,733,194 (GRCm39) E613G probably benign Het
Or10b1 G A 10: 78,355,609 (GRCm39) V56M probably benign Het
Parp8 C T 13: 117,029,562 (GRCm39) V554M probably damaging Het
Phpt1 A T 2: 25,464,750 (GRCm39) D34E probably benign Het
Ppip5k2 G A 1: 97,672,921 (GRCm39) S463L probably benign Het
Prss28 A G 17: 25,530,215 (GRCm39) Q173R probably benign Het
Rtel1 T A 2: 180,988,860 (GRCm39) W441R possibly damaging Het
Serbp1 T C 6: 67,244,025 (GRCm39) probably benign Het
Skint5 T C 4: 113,347,848 (GRCm39) K1319E unknown Het
Slc35a4 G A 18: 36,816,111 (GRCm39) G314S probably damaging Het
Slc8a1 A G 17: 81,956,498 (GRCm39) I180T probably damaging Het
Spire1 G A 18: 67,652,462 (GRCm39) P205L probably benign Het
Tat G T 8: 110,720,547 (GRCm39) G168W probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Trh C T 6: 92,219,939 (GRCm39) G126R probably benign Het
Ugcg G A 4: 59,207,843 (GRCm39) G61R probably damaging Het
Uggt1 T C 1: 36,260,306 (GRCm39) T170A probably benign Het
Unc5b G A 10: 60,608,028 (GRCm39) P702S probably damaging Het
Usp8 A G 2: 126,562,073 (GRCm39) D89G possibly damaging Het
Vmn2r1 T A 3: 64,012,674 (GRCm39) I845K probably damaging Het
Vnn3 A G 10: 23,740,498 (GRCm39) N267S possibly damaging Het
Xkr9 A G 1: 13,771,587 (GRCm39) R368G possibly damaging Het
Other mutations in Col6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Col6a3 APN 1 90,755,977 (GRCm39) missense probably damaging 1.00
IGL00425:Col6a3 APN 1 90,709,748 (GRCm39) missense unknown
IGL00541:Col6a3 APN 1 90,729,864 (GRCm39) missense possibly damaging 0.83
IGL01063:Col6a3 APN 1 90,730,054 (GRCm39) missense probably damaging 1.00
IGL01094:Col6a3 APN 1 90,731,655 (GRCm39) missense possibly damaging 0.93
IGL01138:Col6a3 APN 1 90,735,232 (GRCm39) missense probably damaging 1.00
IGL01291:Col6a3 APN 1 90,730,014 (GRCm39) missense probably damaging 1.00
IGL01674:Col6a3 APN 1 90,730,236 (GRCm39) missense probably damaging 1.00
IGL01756:Col6a3 APN 1 90,706,884 (GRCm39) missense unknown
IGL01827:Col6a3 APN 1 90,730,041 (GRCm39) missense probably damaging 1.00
IGL01845:Col6a3 APN 1 90,724,293 (GRCm39) missense probably damaging 1.00
IGL01869:Col6a3 APN 1 90,700,770 (GRCm39) missense unknown
IGL01900:Col6a3 APN 1 90,722,732 (GRCm39) critical splice donor site probably null
IGL01925:Col6a3 APN 1 90,729,958 (GRCm39) missense possibly damaging 0.95
IGL02002:Col6a3 APN 1 90,709,858 (GRCm39) splice site probably benign
IGL02115:Col6a3 APN 1 90,735,373 (GRCm39) missense probably damaging 0.99
IGL02302:Col6a3 APN 1 90,709,482 (GRCm39) missense unknown
IGL02313:Col6a3 APN 1 90,739,328 (GRCm39) missense probably damaging 1.00
IGL02458:Col6a3 APN 1 90,706,919 (GRCm39) missense unknown
IGL02821:Col6a3 APN 1 90,731,600 (GRCm39) missense probably damaging 1.00
IGL02828:Col6a3 APN 1 90,724,281 (GRCm39) missense probably damaging 1.00
IGL03112:Col6a3 APN 1 90,739,242 (GRCm39) nonsense probably null
IGL03129:Col6a3 APN 1 90,749,584 (GRCm39) missense probably damaging 1.00
IGL03132:Col6a3 APN 1 90,731,615 (GRCm39) missense probably damaging 1.00
IGL03148:Col6a3 APN 1 90,755,588 (GRCm39) missense probably benign 0.33
IGL03251:Col6a3 APN 1 90,737,898 (GRCm39) missense probably damaging 1.00
bailey UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
barnum UTSW 1 90,706,874 (GRCm39) missense unknown
Boneless UTSW 1 90,706,781 (GRCm39) missense unknown
Noodloid UTSW 1 90,707,011 (GRCm39) missense unknown
randolf UTSW 1 90,715,673 (GRCm39) missense unknown
stringy UTSW 1 90,731,400 (GRCm39) nonsense probably null
wonder UTSW 1 90,719,645 (GRCm39) critical splice donor site probably null
ANU05:Col6a3 UTSW 1 90,730,014 (GRCm39) missense probably damaging 1.00
IGL03048:Col6a3 UTSW 1 90,737,970 (GRCm39) missense possibly damaging 0.58
PIT4810001:Col6a3 UTSW 1 90,706,516 (GRCm39) missense unknown
R0020:Col6a3 UTSW 1 90,739,272 (GRCm39) missense probably damaging 0.99
R0020:Col6a3 UTSW 1 90,739,272 (GRCm39) missense probably damaging 0.99
R0033:Col6a3 UTSW 1 90,729,967 (GRCm39) missense probably damaging 1.00
R0033:Col6a3 UTSW 1 90,729,967 (GRCm39) missense probably damaging 1.00
R0105:Col6a3 UTSW 1 90,725,883 (GRCm39) missense possibly damaging 0.65
R0116:Col6a3 UTSW 1 90,741,273 (GRCm39) missense probably damaging 1.00
R0167:Col6a3 UTSW 1 90,725,895 (GRCm39) missense probably damaging 1.00
R0319:Col6a3 UTSW 1 90,735,426 (GRCm39) missense possibly damaging 0.95
R0348:Col6a3 UTSW 1 90,755,771 (GRCm39) missense probably damaging 1.00
R0365:Col6a3 UTSW 1 90,715,938 (GRCm39) missense unknown
R0512:Col6a3 UTSW 1 90,749,520 (GRCm39) intron probably benign
R0564:Col6a3 UTSW 1 90,735,456 (GRCm39) missense probably damaging 1.00
R0635:Col6a3 UTSW 1 90,735,808 (GRCm39) splice site probably null
R0667:Col6a3 UTSW 1 90,755,823 (GRCm39) missense probably damaging 0.98
R0680:Col6a3 UTSW 1 90,706,703 (GRCm39) missense unknown
R0736:Col6a3 UTSW 1 90,731,811 (GRCm39) missense possibly damaging 0.95
R0737:Col6a3 UTSW 1 90,756,020 (GRCm39) missense probably damaging 1.00
R0747:Col6a3 UTSW 1 90,730,375 (GRCm39) missense probably damaging 1.00
R1155:Col6a3 UTSW 1 90,722,047 (GRCm39) missense probably null 1.00
R1169:Col6a3 UTSW 1 90,749,736 (GRCm39) missense possibly damaging 0.67
R1180:Col6a3 UTSW 1 90,709,577 (GRCm39) missense unknown
R1225:Col6a3 UTSW 1 90,739,238 (GRCm39) missense probably damaging 1.00
R1343:Col6a3 UTSW 1 90,696,069 (GRCm39) missense unknown
R1387:Col6a3 UTSW 1 90,750,138 (GRCm39) intron probably benign
R1437:Col6a3 UTSW 1 90,729,098 (GRCm39) missense probably damaging 1.00
R1448:Col6a3 UTSW 1 90,709,577 (GRCm39) missense unknown
R1677:Col6a3 UTSW 1 90,749,583 (GRCm39) missense probably benign 0.14
R1681:Col6a3 UTSW 1 90,701,224 (GRCm39) missense unknown
R1711:Col6a3 UTSW 1 90,757,935 (GRCm39) missense probably damaging 1.00
R1727:Col6a3 UTSW 1 90,724,296 (GRCm39) critical splice acceptor site probably null
R1736:Col6a3 UTSW 1 90,706,781 (GRCm39) missense unknown
R1738:Col6a3 UTSW 1 90,744,083 (GRCm39) missense probably damaging 1.00
R1742:Col6a3 UTSW 1 90,741,516 (GRCm39) missense probably damaging 1.00
R1809:Col6a3 UTSW 1 90,755,671 (GRCm39) missense probably damaging 1.00
R1851:Col6a3 UTSW 1 90,735,256 (GRCm39) missense possibly damaging 0.69
R1852:Col6a3 UTSW 1 90,735,256 (GRCm39) missense possibly damaging 0.69
R1872:Col6a3 UTSW 1 90,757,936 (GRCm39) missense probably damaging 0.96
R1889:Col6a3 UTSW 1 90,731,433 (GRCm39) missense probably benign 0.00
R1895:Col6a3 UTSW 1 90,731,433 (GRCm39) missense probably benign 0.00
R1908:Col6a3 UTSW 1 90,739,421 (GRCm39) missense probably damaging 1.00
R1919:Col6a3 UTSW 1 90,750,081 (GRCm39) missense possibly damaging 0.66
R1973:Col6a3 UTSW 1 90,731,897 (GRCm39) missense probably damaging 1.00
R2083:Col6a3 UTSW 1 90,709,733 (GRCm39) missense unknown
R2121:Col6a3 UTSW 1 90,738,087 (GRCm39) missense probably damaging 1.00
R2197:Col6a3 UTSW 1 90,731,467 (GRCm39) missense probably benign 0.09
R2448:Col6a3 UTSW 1 90,741,080 (GRCm39) missense probably damaging 1.00
R2831:Col6a3 UTSW 1 90,731,435 (GRCm39) missense possibly damaging 0.89
R2877:Col6a3 UTSW 1 90,703,321 (GRCm39) missense unknown
R3052:Col6a3 UTSW 1 90,729,852 (GRCm39) missense possibly damaging 0.71
R3104:Col6a3 UTSW 1 90,744,024 (GRCm39) missense probably damaging 0.99
R3105:Col6a3 UTSW 1 90,744,024 (GRCm39) missense probably damaging 0.99
R3106:Col6a3 UTSW 1 90,744,024 (GRCm39) missense probably damaging 0.99
R3418:Col6a3 UTSW 1 90,731,813 (GRCm39) missense probably benign 0.42
R3419:Col6a3 UTSW 1 90,731,813 (GRCm39) missense probably benign 0.42
R3837:Col6a3 UTSW 1 90,707,803 (GRCm39) missense unknown
R4007:Col6a3 UTSW 1 90,730,291 (GRCm39) missense probably damaging 1.00
R4082:Col6a3 UTSW 1 90,749,605 (GRCm39) missense probably damaging 1.00
R4181:Col6a3 UTSW 1 90,735,336 (GRCm39) missense probably damaging 1.00
R4200:Col6a3 UTSW 1 90,729,105 (GRCm39) missense probably benign 0.28
R4244:Col6a3 UTSW 1 90,714,361 (GRCm39) missense unknown
R4297:Col6a3 UTSW 1 90,739,100 (GRCm39) missense probably damaging 1.00
R4302:Col6a3 UTSW 1 90,735,336 (GRCm39) missense probably damaging 1.00
R4472:Col6a3 UTSW 1 90,749,736 (GRCm39) missense probably benign 0.23
R4600:Col6a3 UTSW 1 90,709,626 (GRCm39) missense unknown
R4683:Col6a3 UTSW 1 90,701,179 (GRCm39) missense unknown
R4788:Col6a3 UTSW 1 90,700,672 (GRCm39) critical splice donor site probably null
R4851:Col6a3 UTSW 1 90,707,011 (GRCm39) missense unknown
R4899:Col6a3 UTSW 1 90,730,149 (GRCm39) missense probably damaging 0.99
R4904:Col6a3 UTSW 1 90,729,164 (GRCm39) missense probably damaging 1.00
R4908:Col6a3 UTSW 1 90,735,246 (GRCm39) missense probably damaging 1.00
R4960:Col6a3 UTSW 1 90,731,940 (GRCm39) missense probably damaging 1.00
R4981:Col6a3 UTSW 1 90,706,565 (GRCm39) missense unknown
R5057:Col6a3 UTSW 1 90,743,852 (GRCm39) missense possibly damaging 0.91
R5062:Col6a3 UTSW 1 90,707,074 (GRCm39) missense unknown
R5105:Col6a3 UTSW 1 90,725,862 (GRCm39) missense possibly damaging 0.81
R5127:Col6a3 UTSW 1 90,696,067 (GRCm39) missense unknown
R5166:Col6a3 UTSW 1 90,738,330 (GRCm39) missense probably damaging 1.00
R5168:Col6a3 UTSW 1 90,701,361 (GRCm39) nonsense probably null
R5196:Col6a3 UTSW 1 90,744,260 (GRCm39) splice site probably null
R5230:Col6a3 UTSW 1 90,716,776 (GRCm39) missense unknown
R5268:Col6a3 UTSW 1 90,712,965 (GRCm39) missense unknown
R5381:Col6a3 UTSW 1 90,703,334 (GRCm39) missense unknown
R5392:Col6a3 UTSW 1 90,729,017 (GRCm39) missense probably benign 0.41
R5445:Col6a3 UTSW 1 90,709,761 (GRCm39) nonsense probably null
R5571:Col6a3 UTSW 1 90,715,938 (GRCm39) missense unknown
R5665:Col6a3 UTSW 1 90,755,602 (GRCm39) missense probably benign 0.00
R5902:Col6a3 UTSW 1 90,729,921 (GRCm39) splice site probably null
R5914:Col6a3 UTSW 1 90,703,922 (GRCm39) missense unknown
R5955:Col6a3 UTSW 1 90,739,163 (GRCm39) missense probably damaging 1.00
R5977:Col6a3 UTSW 1 90,749,571 (GRCm39) missense possibly damaging 0.82
R6006:Col6a3 UTSW 1 90,696,105 (GRCm39) missense unknown
R6010:Col6a3 UTSW 1 90,701,219 (GRCm39) missense unknown
R6025:Col6a3 UTSW 1 90,755,824 (GRCm39) missense probably damaging 1.00
R6151:Col6a3 UTSW 1 90,741,475 (GRCm39) missense possibly damaging 0.53
R6154:Col6a3 UTSW 1 90,701,387 (GRCm39) missense unknown
R6181:Col6a3 UTSW 1 90,744,096 (GRCm39) missense possibly damaging 0.95
R6197:Col6a3 UTSW 1 90,750,063 (GRCm39) missense probably damaging 1.00
R6332:Col6a3 UTSW 1 90,749,955 (GRCm39) missense probably damaging 1.00
R6362:Col6a3 UTSW 1 90,738,285 (GRCm39) missense probably damaging 0.99
R6476:Col6a3 UTSW 1 90,709,534 (GRCm39) missense unknown
R6484:Col6a3 UTSW 1 90,719,645 (GRCm39) critical splice donor site probably null
R6701:Col6a3 UTSW 1 90,720,184 (GRCm39) missense probably benign 0.14
R6702:Col6a3 UTSW 1 90,707,161 (GRCm39) missense unknown
R6703:Col6a3 UTSW 1 90,720,184 (GRCm39) missense probably benign 0.14
R6703:Col6a3 UTSW 1 90,707,161 (GRCm39) missense unknown
R6724:Col6a3 UTSW 1 90,706,874 (GRCm39) missense unknown
R6746:Col6a3 UTSW 1 90,706,767 (GRCm39) missense unknown
R6797:Col6a3 UTSW 1 90,731,810 (GRCm39) missense probably damaging 0.99
R6798:Col6a3 UTSW 1 90,722,731 (GRCm39) splice site probably null
R6903:Col6a3 UTSW 1 90,721,929 (GRCm39) missense probably damaging 1.00
R6925:Col6a3 UTSW 1 90,743,724 (GRCm39) missense probably benign 0.00
R6978:Col6a3 UTSW 1 90,735,192 (GRCm39) critical splice donor site probably null
R7058:Col6a3 UTSW 1 90,755,759 (GRCm39) nonsense probably null
R7182:Col6a3 UTSW 1 90,731,400 (GRCm39) nonsense probably null
R7294:Col6a3 UTSW 1 90,756,005 (GRCm39) missense probably damaging 1.00
R7296:Col6a3 UTSW 1 90,755,708 (GRCm39) missense probably benign 0.00
R7311:Col6a3 UTSW 1 90,750,013 (GRCm39) missense probably damaging 1.00
R7412:Col6a3 UTSW 1 90,755,855 (GRCm39) missense probably damaging 0.98
R7561:Col6a3 UTSW 1 90,703,463 (GRCm39) missense unknown
R7575:Col6a3 UTSW 1 90,738,321 (GRCm39) missense possibly damaging 0.92
R7659:Col6a3 UTSW 1 90,709,467 (GRCm39) missense unknown
R7679:Col6a3 UTSW 1 90,739,473 (GRCm39) missense possibly damaging 0.49
R7831:Col6a3 UTSW 1 90,724,268 (GRCm39) nonsense probably null
R7855:Col6a3 UTSW 1 90,738,343 (GRCm39) missense possibly damaging 0.57
R7990:Col6a3 UTSW 1 90,709,577 (GRCm39) missense unknown
R8003:Col6a3 UTSW 1 90,703,455 (GRCm39) missense unknown
R8007:Col6a3 UTSW 1 90,705,179 (GRCm39) missense unknown
R8098:Col6a3 UTSW 1 90,731,383 (GRCm39) missense probably benign
R8312:Col6a3 UTSW 1 90,741,412 (GRCm39) missense possibly damaging 0.55
R8419:Col6a3 UTSW 1 90,729,935 (GRCm39) missense probably damaging 1.00
R8723:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8725:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8737:Col6a3 UTSW 1 90,727,747 (GRCm39) missense probably benign 0.10
R8742:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8743:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8744:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8753:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8754:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8773:Col6a3 UTSW 1 90,696,171 (GRCm39) missense unknown
R8857:Col6a3 UTSW 1 90,703,485 (GRCm39) missense unknown
R8867:Col6a3 UTSW 1 90,715,673 (GRCm39) missense unknown
R8887:Col6a3 UTSW 1 90,755,948 (GRCm39) missense probably benign
R9011:Col6a3 UTSW 1 90,710,057 (GRCm39) splice site probably benign
R9049:Col6a3 UTSW 1 90,707,066 (GRCm39) missense unknown
R9142:Col6a3 UTSW 1 90,706,566 (GRCm39) missense unknown
R9155:Col6a3 UTSW 1 90,738,301 (GRCm39) missense probably benign 0.27
R9249:Col6a3 UTSW 1 90,707,020 (GRCm39) missense unknown
R9258:Col6a3 UTSW 1 90,700,703 (GRCm39) missense unknown
R9274:Col6a3 UTSW 1 90,707,020 (GRCm39) missense unknown
R9276:Col6a3 UTSW 1 90,735,403 (GRCm39) missense possibly damaging 0.94
R9315:Col6a3 UTSW 1 90,738,979 (GRCm39) critical splice donor site probably null
R9376:Col6a3 UTSW 1 90,709,523 (GRCm39) missense unknown
R9377:Col6a3 UTSW 1 90,743,961 (GRCm39) missense probably damaging 1.00
R9429:Col6a3 UTSW 1 90,731,585 (GRCm39) missense probably benign 0.01
R9439:Col6a3 UTSW 1 90,744,155 (GRCm39) missense probably damaging 1.00
R9440:Col6a3 UTSW 1 90,707,068 (GRCm39) missense unknown
R9477:Col6a3 UTSW 1 90,706,621 (GRCm39) missense unknown
R9498:Col6a3 UTSW 1 90,713,650 (GRCm39) nonsense probably null
R9528:Col6a3 UTSW 1 90,731,789 (GRCm39) missense probably damaging 1.00
R9602:Col6a3 UTSW 1 90,731,497 (GRCm39) missense probably benign 0.07
RF005:Col6a3 UTSW 1 90,738,984 (GRCm39) missense probably benign 0.00
RF012:Col6a3 UTSW 1 90,738,282 (GRCm39) missense probably damaging 1.00
X0024:Col6a3 UTSW 1 90,731,359 (GRCm39) critical splice donor site probably null
X0063:Col6a3 UTSW 1 90,731,627 (GRCm39) missense probably damaging 1.00
X0067:Col6a3 UTSW 1 90,739,251 (GRCm39) missense probably damaging 1.00
Z1177:Col6a3 UTSW 1 90,739,450 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AATCCATGAAGCTAGGGATTGGC -3'
(R):5'- CGGAGAACCTTGAACATAACTGG -3'

Sequencing Primer
(F):5'- CTAGGGATTGGCTGGAGAGC -3'
(R):5'- CATCCAAGTAGTTATGCAAC -3'
Posted On 2022-06-15