Incidental Mutation 'R9441:Armc3'
ID 713623
Institutional Source Beutler Lab
Gene Symbol Armc3
Ensembl Gene ENSMUSG00000037683
Gene Name armadillo repeat containing 3
Synonyms 4921513G22Rik
Accession Numbers

Ncbi RefSeq: NM_001081083.2, NM_001271563.1, NM_001271564.1, NM_001271565.1; MGI:1918132

Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R9441 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 19199302-19310241 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 19248615 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 189 (E189A)
Ref Sequence ENSEMBL: ENSMUSP00000110287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049255] [ENSMUST00000114640]
AlphaFold A2AU72
Predicted Effect possibly damaging
Transcript: ENSMUST00000049255
AA Change: E189A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048784
Gene: ENSMUSG00000037683
AA Change: E189A

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
ARM 56 96 2.07e-2 SMART
ARM 97 138 9.84e1 SMART
ARM 139 179 7.86e-3 SMART
ARM 180 220 7.63e0 SMART
ARM 221 262 7.76e1 SMART
low complexity region 293 303 N/A INTRINSIC
ARM 305 345 3.91e1 SMART
ARM 346 385 2.93e-2 SMART
ARM 387 427 7.74e-2 SMART
Blast:ARM 428 468 3e-11 BLAST
ARM 469 509 1.45e-1 SMART
low complexity region 544 557 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
low complexity region 675 696 N/A INTRINSIC
Pfam:EDR1 723 857 3.1e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114640
AA Change: E189A

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110287
Gene: ENSMUSG00000037683
AA Change: E189A

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
ARM 56 96 2.07e-2 SMART
ARM 97 138 9.84e1 SMART
ARM 139 179 7.86e-3 SMART
ARM 180 220 7.63e0 SMART
ARM 221 262 7.76e1 SMART
low complexity region 293 303 N/A INTRINSIC
ARM 305 345 3.91e1 SMART
ARM 346 385 2.93e-2 SMART
ARM 387 427 7.74e-2 SMART
Blast:ARM 428 468 3e-11 BLAST
ARM 469 509 1.45e-1 SMART
Pfam:EDR1 549 868 1.4e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo/beta-catenin (CTNNB1; MIM 116806)-like (ARM) domains are imperfect 45-amino acid repeats involved in protein-protein interactions. ARM domain-containing proteins, such as ARMC3, function in signal transduction, development, cell adhesion and mobility, and tumor initiation and metastasis (Li et al., 2006 [PubMed 16915934]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik C A 9: 56,010,492 G20V unknown Het
Adam22 T C 5: 8,111,974 T733A possibly damaging Het
Adam28 T A 14: 68,637,494 N245Y probably damaging Het
Aldh9a1 C G 1: 167,350,350 R39G probably benign Het
Atg9a C T 1: 75,186,442 C338Y possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cars G A 7: 143,569,448 T560I probably benign Het
Casp8ap2 A G 4: 32,645,873 K1649E probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cd84 G A 1: 171,886,427 probably null Het
Ces2g G T 8: 104,963,991 A135S possibly damaging Het
Cfh T C 1: 140,102,411 D926G probably benign Het
Chrm2 A G 6: 36,524,020 T271A probably benign Het
Col6a3 G T 1: 90,777,527 Y2824* probably null Het
Cth T A 3: 157,910,938 R196S probably damaging Het
Cyp2g1 T C 7: 26,814,635 M222T possibly damaging Het
Depdc5 T A 5: 32,937,698 M773K probably benign Het
Dmbx1 G A 4: 115,923,687 P39L probably damaging Het
Dst G C 1: 34,199,351 W1697C probably damaging Het
E330017A01Rik G A 16: 58,638,521 probably benign Het
Eno1 C T 4: 150,236,751 probably benign Het
Erc2 G T 14: 28,080,157 V761L possibly damaging Het
Frem1 A T 4: 83,005,846 I292N probably damaging Het
Hip1 G T 5: 135,431,717 L530M possibly damaging Het
Kcna2 A G 3: 107,104,952 Q283R probably benign Het
Kndc1 G A 7: 139,921,476 D894N probably damaging Het
Lats1 G T 10: 7,702,917 G602W probably damaging Het
Lgals12 A G 19: 7,603,991 L117P probably damaging Het
Mfsd4b1 A T 10: 40,002,684 L406I possibly damaging Het
Msln A T 17: 25,750,757 M333K probably benign Het
Mup2 A G 4: 60,139,740 V16A probably benign Het
Mybpc2 T C 7: 44,516,906 E220G probably null Het
Myh6 A G 14: 54,960,314 Y456H probably benign Het
Nlrp1a A G 11: 71,123,108 S439P probably damaging Het
Nyap1 T C 5: 137,734,932 E613G probably benign Het
Olfr1358 G A 10: 78,519,775 V56M probably benign Het
Parp8 C T 13: 116,893,026 V554M probably damaging Het
Phpt1 A T 2: 25,574,738 D34E probably benign Het
Ppip5k2 G A 1: 97,745,196 S463L probably benign Het
Prss28 A G 17: 25,311,241 Q173R probably benign Het
Rtel1 T A 2: 181,347,067 W441R possibly damaging Het
Serbp1 T C 6: 67,267,041 probably benign Het
Skint5 T C 4: 113,490,651 K1319E unknown Het
Slc35a4 G A 18: 36,683,058 G314S probably damaging Het
Slc8a1 A G 17: 81,649,069 I180T probably damaging Het
Spire1 G A 18: 67,519,392 P205L probably benign Het
Tat G T 8: 109,993,915 G168W probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Trh C T 6: 92,242,958 G126R probably benign Het
Ugcg G A 4: 59,207,843 G61R probably damaging Het
Uggt1 T C 1: 36,221,225 T170A probably benign Het
Unc5b G A 10: 60,772,249 P702S probably damaging Het
Usp8 A G 2: 126,720,153 D89G possibly damaging Het
Vmn2r1 T A 3: 64,105,253 I845K probably damaging Het
Vnn3 A G 10: 23,864,600 N267S possibly damaging Het
Xkr9 A G 1: 13,701,363 R368G possibly damaging Het
Other mutations in Armc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Armc3 APN 2 19303858 missense possibly damaging 0.48
IGL01123:Armc3 APN 2 19201805 missense possibly damaging 0.87
IGL01142:Armc3 APN 2 19297898 splice site probably benign
IGL01556:Armc3 APN 2 19269146 missense probably damaging 1.00
IGL02145:Armc3 APN 2 19296860 missense possibly damaging 0.81
IGL02145:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02152:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02154:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02243:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02244:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02516:Armc3 APN 2 19300506 missense possibly damaging 0.94
IGL02691:Armc3 APN 2 19235484 missense probably damaging 1.00
IGL03151:Armc3 APN 2 19238698 missense probably damaging 1.00
IGL03190:Armc3 APN 2 19288950 missense probably damaging 0.99
IGL03288:Armc3 APN 2 19235482 missense probably damaging 1.00
IGL03338:Armc3 APN 2 19248701 missense possibly damaging 0.88
R0015:Armc3 UTSW 2 19296321 critical splice acceptor site probably null
R0015:Armc3 UTSW 2 19296321 critical splice acceptor site probably null
R0256:Armc3 UTSW 2 19269216 missense probably damaging 1.00
R0621:Armc3 UTSW 2 19295393 missense probably damaging 0.96
R1326:Armc3 UTSW 2 19310124 makesense probably null
R1470:Armc3 UTSW 2 19238736 missense probably benign
R1470:Armc3 UTSW 2 19238736 missense probably benign
R1489:Armc3 UTSW 2 19310047 missense probably benign 0.01
R1990:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R1991:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R1992:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R2002:Armc3 UTSW 2 19288936 missense probably benign 0.01
R2095:Armc3 UTSW 2 19288929 missense possibly damaging 0.65
R2127:Armc3 UTSW 2 19201811 missense probably damaging 1.00
R2158:Armc3 UTSW 2 19248633 missense probably damaging 0.99
R2697:Armc3 UTSW 2 19303935 missense probably damaging 1.00
R3809:Armc3 UTSW 2 19300665 missense probably damaging 1.00
R3897:Armc3 UTSW 2 19269177 missense probably damaging 1.00
R4107:Armc3 UTSW 2 19288909 missense probably benign 0.13
R4326:Armc3 UTSW 2 19300473 missense probably damaging 0.97
R4464:Armc3 UTSW 2 19248659 missense probably damaging 0.99
R4702:Armc3 UTSW 2 19309981 missense probably damaging 1.00
R4923:Armc3 UTSW 2 19292980 critical splice acceptor site probably null
R5370:Armc3 UTSW 2 19286062 missense probably benign 0.00
R5518:Armc3 UTSW 2 19297928 missense probably benign 0.28
R5718:Armc3 UTSW 2 19303799 nonsense probably null
R5739:Armc3 UTSW 2 19253917 missense possibly damaging 0.67
R5913:Armc3 UTSW 2 19310047 missense possibly damaging 0.65
R6211:Armc3 UTSW 2 19296803 critical splice acceptor site probably null
R6245:Armc3 UTSW 2 19248705 missense probably damaging 1.00
R6841:Armc3 UTSW 2 19201819 splice site probably null
R7003:Armc3 UTSW 2 19270028 missense probably damaging 1.00
R7190:Armc3 UTSW 2 19293136 missense probably damaging 1.00
R7499:Armc3 UTSW 2 19285979 missense probably benign 0.03
R7738:Armc3 UTSW 2 19288950 missense probably damaging 0.99
R7844:Armc3 UTSW 2 19254018 missense possibly damaging 0.90
R7919:Armc3 UTSW 2 19286095 missense probably benign 0.00
R8060:Armc3 UTSW 2 19288909 missense probably benign 0.08
R8111:Armc3 UTSW 2 19296863 missense probably benign
R8406:Armc3 UTSW 2 19235554 missense probably damaging 0.98
R8485:Armc3 UTSW 2 19293134 missense probably damaging 1.00
R8773:Armc3 UTSW 2 19288856 missense probably benign 0.01
R8940:Armc3 UTSW 2 19235582 missense probably damaging 1.00
Z1177:Armc3 UTSW 2 19285991 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTCCTTTGACAACGTCTGCAC -3'
(R):5'- CATGAGTACCTTGGTCTCCAG -3'

Sequencing Primer
(F):5'- CCATGAAGAGTTTTCTTTTGTCCG -3'
(R):5'- AGTACCTTGGTCTCCAGGATCTTG -3'
Posted On 2022-06-15