Mutagenetix > Incidental Mutation

Incidental Mutation 'R9441:Armc3'

713623

Institutional Source

Beutler Lab

Gene Symbol

Armc3

Ensembl Gene

ENSMUSG00000037683

Gene Name

armadillo repeat containing 3

Synonyms

4921513G22Rik

Accession Numbers

Ncbi RefSeq: NM_001081083.2, NM_001271563.1, NM_001271564.1, NM_001271565.1; MGI:1918132

Is this an essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R9441 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

19199302-19310241 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 19248615 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 189 (E189A)

Ref Sequence

ENSEMBL: ENSMUSP00000110287 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049255] [ENSMUST00000114640]

AlphaFold

A2AU72

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049255
AA Change: E189A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000048784
Gene: ENSMUSG00000037683
AA Change: E189A

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
ARM	56	96	2.07e-2	SMART
ARM	97	138	9.84e1	SMART
ARM	139	179	7.86e-3	SMART
ARM	180	220	7.63e0	SMART
ARM	221	262	7.76e1	SMART
low complexity region	293	303	N/A	INTRINSIC
ARM	305	345	3.91e1	SMART
ARM	346	385	2.93e-2	SMART
ARM	387	427	7.74e-2	SMART
Blast:ARM	428	468	3e-11	BLAST
ARM	469	509	1.45e-1	SMART
low complexity region	544	557	N/A	INTRINSIC
low complexity region	583	595	N/A	INTRINSIC
low complexity region	620	639	N/A	INTRINSIC
low complexity region	675	696	N/A	INTRINSIC
Pfam:EDR1	723	857	3.1e-28	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114640
AA Change: E189A

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110287
Gene: ENSMUSG00000037683
AA Change: E189A

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
ARM	56	96	2.07e-2	SMART
ARM	97	138	9.84e1	SMART
ARM	139	179	7.86e-3	SMART
ARM	180	220	7.63e0	SMART
ARM	221	262	7.76e1	SMART
low complexity region	293	303	N/A	INTRINSIC
ARM	305	345	3.91e1	SMART
ARM	346	385	2.93e-2	SMART
ARM	387	427	7.74e-2	SMART
Blast:ARM	428	468	3e-11	BLAST
ARM	469	509	1.45e-1	SMART
Pfam:EDR1	549	868	1.4e-41	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo/beta-catenin (CTNNB1; MIM 116806)-like (ARM) domains are imperfect 45-amino acid repeats involved in protein-protein interactions. ARM domain-containing proteins, such as ARMC3, function in signal transduction, development, cell adhesion and mobility, and tumor initiation and metastasis (Li et al., 2006 [PubMed 16915934]).[supplied by OMIM, Mar 2008]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	C	A	9: 56,010,492	G20V	unknown	Het
Adam22	T	C	5: 8,111,974	T733A	possibly damaging	Het
Adam28	T	A	14: 68,637,494	N245Y	probably damaging	Het
Aldh9a1	C	G	1: 167,350,350	R39G	probably benign	Het
Atg9a	C	T	1: 75,186,442	C338Y	possibly damaging	Het
Card6	TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG	TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG	15: 5,098,691		probably benign	Het
Cars	G	A	7: 143,569,448	T560I	probably benign	Het
Casp8ap2	A	G	4: 32,645,873	K1649E	probably benign	Het
Ccdc88b	T	C	19: 6,855,845	E278G	probably damaging	Het
Cd84	G	A	1: 171,886,427		probably null	Het
Ces2g	G	T	8: 104,963,991	A135S	possibly damaging	Het
Cfh	T	C	1: 140,102,411	D926G	probably benign	Het
Chrm2	A	G	6: 36,524,020	T271A	probably benign	Het
Col6a3	G	T	1: 90,777,527	Y2824*	probably null	Het
Cth	T	A	3: 157,910,938	R196S	probably damaging	Het
Cyp2g1	T	C	7: 26,814,635	M222T	possibly damaging	Het
Depdc5	T	A	5: 32,937,698	M773K	probably benign	Het
Dmbx1	G	A	4: 115,923,687	P39L	probably damaging	Het
Dst	G	C	1: 34,199,351	W1697C	probably damaging	Het
E330017A01Rik	G	A	16: 58,638,521		probably benign	Het
Eno1	C	T	4: 150,236,751		probably benign	Het
Erc2	G	T	14: 28,080,157	V761L	possibly damaging	Het
Frem1	A	T	4: 83,005,846	I292N	probably damaging	Het
Hip1	G	T	5: 135,431,717	L530M	possibly damaging	Het
Kcna2	A	G	3: 107,104,952	Q283R	probably benign	Het
Kndc1	G	A	7: 139,921,476	D894N	probably damaging	Het
Lats1	G	T	10: 7,702,917	G602W	probably damaging	Het
Lgals12	A	G	19: 7,603,991	L117P	probably damaging	Het
Mfsd4b1	A	T	10: 40,002,684	L406I	possibly damaging	Het
Msln	A	T	17: 25,750,757	M333K	probably benign	Het
Mup2	A	G	4: 60,139,740	V16A	probably benign	Het
Mybpc2	T	C	7: 44,516,906	E220G	probably null	Het
Myh6	A	G	14: 54,960,314	Y456H	probably benign	Het
Nlrp1a	A	G	11: 71,123,108	S439P	probably damaging	Het
Nyap1	T	C	5: 137,734,932	E613G	probably benign	Het
Olfr1358	G	A	10: 78,519,775	V56M	probably benign	Het
Parp8	C	T	13: 116,893,026	V554M	probably damaging	Het
Phpt1	A	T	2: 25,574,738	D34E	probably benign	Het
Ppip5k2	G	A	1: 97,745,196	S463L	probably benign	Het
Prss28	A	G	17: 25,311,241	Q173R	probably benign	Het
Rtel1	T	A	2: 181,347,067	W441R	possibly damaging	Het
Serbp1	T	C	6: 67,267,041		probably benign	Het
Skint5	T	C	4: 113,490,651	K1319E	unknown	Het
Slc35a4	G	A	18: 36,683,058	G314S	probably damaging	Het
Slc8a1	A	G	17: 81,649,069	I180T	probably damaging	Het
Spire1	G	A	18: 67,519,392	P205L	probably benign	Het
Tat	G	T	8: 109,993,915	G168W	probably damaging	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Trh	C	T	6: 92,242,958	G126R	probably benign	Het
Ugcg	G	A	4: 59,207,843	G61R	probably damaging	Het
Uggt1	T	C	1: 36,221,225	T170A	probably benign	Het
Unc5b	G	A	10: 60,772,249	P702S	probably damaging	Het
Usp8	A	G	2: 126,720,153	D89G	possibly damaging	Het
Vmn2r1	T	A	3: 64,105,253	I845K	probably damaging	Het
Vnn3	A	G	10: 23,864,600	N267S	possibly damaging	Het
Xkr9	A	G	1: 13,701,363	R368G	possibly damaging	Het

Other mutations in Armc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00535:Armc3	APN	2	19303858	missense	possibly damaging	0.48
IGL01123:Armc3	APN	2	19201805	missense	possibly damaging	0.87
IGL01142:Armc3	APN	2	19297898	splice site	probably benign
IGL01556:Armc3	APN	2	19269146	missense	probably damaging	1.00
IGL02145:Armc3	APN	2	19296860	missense	possibly damaging	0.81
IGL02145:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02152:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02154:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02243:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02244:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02516:Armc3	APN	2	19300506	missense	possibly damaging	0.94
IGL02691:Armc3	APN	2	19235484	missense	probably damaging	1.00
IGL03151:Armc3	APN	2	19238698	missense	probably damaging	1.00
IGL03190:Armc3	APN	2	19288950	missense	probably damaging	0.99
IGL03288:Armc3	APN	2	19235482	missense	probably damaging	1.00
IGL03338:Armc3	APN	2	19248701	missense	possibly damaging	0.88
R0015:Armc3	UTSW	2	19296321	critical splice acceptor site	probably null
R0015:Armc3	UTSW	2	19296321	critical splice acceptor site	probably null
R0256:Armc3	UTSW	2	19269216	missense	probably damaging	1.00
R0621:Armc3	UTSW	2	19295393	missense	probably damaging	0.96
R1326:Armc3	UTSW	2	19310124	makesense	probably null
R1470:Armc3	UTSW	2	19238736	missense	probably benign
R1470:Armc3	UTSW	2	19238736	missense	probably benign
R1489:Armc3	UTSW	2	19310047	missense	probably benign	0.01
R1990:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R1991:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R1992:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R2002:Armc3	UTSW	2	19288936	missense	probably benign	0.01
R2095:Armc3	UTSW	2	19288929	missense	possibly damaging	0.65
R2127:Armc3	UTSW	2	19201811	missense	probably damaging	1.00
R2158:Armc3	UTSW	2	19248633	missense	probably damaging	0.99
R2697:Armc3	UTSW	2	19303935	missense	probably damaging	1.00
R3809:Armc3	UTSW	2	19300665	missense	probably damaging	1.00
R3897:Armc3	UTSW	2	19269177	missense	probably damaging	1.00
R4107:Armc3	UTSW	2	19288909	missense	probably benign	0.13
R4326:Armc3	UTSW	2	19300473	missense	probably damaging	0.97
R4464:Armc3	UTSW	2	19248659	missense	probably damaging	0.99
R4702:Armc3	UTSW	2	19309981	missense	probably damaging	1.00
R4923:Armc3	UTSW	2	19292980	critical splice acceptor site	probably null
R5370:Armc3	UTSW	2	19286062	missense	probably benign	0.00
R5518:Armc3	UTSW	2	19297928	missense	probably benign	0.28
R5718:Armc3	UTSW	2	19303799	nonsense	probably null
R5739:Armc3	UTSW	2	19253917	missense	possibly damaging	0.67
R5913:Armc3	UTSW	2	19310047	missense	possibly damaging	0.65
R6211:Armc3	UTSW	2	19296803	critical splice acceptor site	probably null
R6245:Armc3	UTSW	2	19248705	missense	probably damaging	1.00
R6841:Armc3	UTSW	2	19201819	splice site	probably null
R7003:Armc3	UTSW	2	19270028	missense	probably damaging	1.00
R7190:Armc3	UTSW	2	19293136	missense	probably damaging	1.00
R7499:Armc3	UTSW	2	19285979	missense	probably benign	0.03
R7738:Armc3	UTSW	2	19288950	missense	probably damaging	0.99
R7844:Armc3	UTSW	2	19254018	missense	possibly damaging	0.90
R7919:Armc3	UTSW	2	19286095	missense	probably benign	0.00
R8060:Armc3	UTSW	2	19288909	missense	probably benign	0.08
R8111:Armc3	UTSW	2	19296863	missense	probably benign
R8406:Armc3	UTSW	2	19235554	missense	probably damaging	0.98
R8485:Armc3	UTSW	2	19293134	missense	probably damaging	1.00
R8773:Armc3	UTSW	2	19288856	missense	probably benign	0.01
R8940:Armc3	UTSW	2	19235582	missense	probably damaging	1.00
Z1177:Armc3	UTSW	2	19285991	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTTCCTTTGACAACGTCTGCAC -3'
(R):5'- CATGAGTACCTTGGTCTCCAG -3'

Sequencing Primer
(F):5'- CCATGAAGAGTTTTCTTTTGTCCG -3'
(R):5'- AGTACCTTGGTCTCCAGGATCTTG -3'

Posted On

2022-06-15