Incidental Mutation 'R9441:Nyap1'
ID 713640
Institutional Source Beutler Lab
Gene Symbol Nyap1
Ensembl Gene ENSMUSG00000045348
Gene Name neuronal tyrosine-phosphorylated phosphoinositide 3-kinase adaptor 1
Synonyms 6430598A04Rik, Nyap1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.143) question?
Stock # R9441 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 137729144-137739430 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 137733194 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 613 (E613G)
Ref Sequence ENSEMBL: ENSMUSP00000113397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061789] [ENSMUST00000118326] [ENSMUST00000149512] [ENSMUST00000212152]
AlphaFold Q6PFX7
Predicted Effect probably benign
Transcript: ENSMUST00000061789
AA Change: E613G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000058217
Gene: ENSMUSG00000045348
AA Change: E613G

DomainStartEndE-ValueType
Pfam:NYAP_N 15 411 1.5e-127 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 528 833 1.7e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118326
AA Change: E613G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113397
Gene: ENSMUSG00000045348
AA Change: E613G

DomainStartEndE-ValueType
Pfam:NYAP_N 15 411 1.5e-127 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 528 833 1.7e-180 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000149512
AA Change: E613G

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114694
Gene: ENSMUSG00000045348
AA Change: E613G

DomainStartEndE-ValueType
Pfam:NYAP_N 15 411 7.1e-128 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 528 771 1.9e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212152
AA Change: E613G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik C A 9: 55,917,776 (GRCm39) G20V unknown Het
Adam22 T C 5: 8,161,974 (GRCm39) T733A possibly damaging Het
Adam28 T A 14: 68,874,943 (GRCm39) N245Y probably damaging Het
Aldh9a1 C G 1: 167,177,919 (GRCm39) R39G probably benign Het
Armc3 A C 2: 19,253,426 (GRCm39) E189A possibly damaging Het
Atg9a C T 1: 75,163,086 (GRCm39) C338Y possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,128,173 (GRCm39) probably benign Het
Cars1 G A 7: 143,123,185 (GRCm39) T560I probably benign Het
Casp8ap2 A G 4: 32,645,873 (GRCm39) K1649E probably benign Het
Ccdc88b T C 19: 6,833,213 (GRCm39) E278G probably damaging Het
Cd84 G A 1: 171,713,994 (GRCm39) probably null Het
Ces2g G T 8: 105,690,623 (GRCm39) A135S possibly damaging Het
Cfh T C 1: 140,030,149 (GRCm39) D926G probably benign Het
Chrm2 A G 6: 36,500,955 (GRCm39) T271A probably benign Het
Col6a3 G T 1: 90,705,249 (GRCm39) Y2824* probably null Het
Cth T A 3: 157,616,575 (GRCm39) R196S probably damaging Het
Cyp2g1 T C 7: 26,514,060 (GRCm39) M222T possibly damaging Het
Depdc5 T A 5: 33,095,042 (GRCm39) M773K probably benign Het
Dmbx1 G A 4: 115,780,884 (GRCm39) P39L probably damaging Het
Dst G C 1: 34,238,432 (GRCm39) W1697C probably damaging Het
Eno1 C T 4: 150,321,208 (GRCm39) probably benign Het
Erc2 G T 14: 27,802,114 (GRCm39) V761L possibly damaging Het
Frem1 A T 4: 82,924,083 (GRCm39) I292N probably damaging Het
Ftdc2 G A 16: 58,458,884 (GRCm39) probably benign Het
Hip1 G T 5: 135,460,571 (GRCm39) L530M possibly damaging Het
Kcna2 A G 3: 107,012,268 (GRCm39) Q283R probably benign Het
Kndc1 G A 7: 139,501,392 (GRCm39) D894N probably damaging Het
Lats1 G T 10: 7,578,681 (GRCm39) G602W probably damaging Het
Lgals12 A G 19: 7,581,356 (GRCm39) L117P probably damaging Het
Mfsd4b1 A T 10: 39,878,680 (GRCm39) L406I possibly damaging Het
Msln A T 17: 25,969,731 (GRCm39) M333K probably benign Het
Mup2 A G 4: 60,139,740 (GRCm39) V16A probably benign Het
Mybpc2 T C 7: 44,166,330 (GRCm39) E220G probably null Het
Myh6 A G 14: 55,197,771 (GRCm39) Y456H probably benign Het
Nlrp1a A G 11: 71,013,934 (GRCm39) S439P probably damaging Het
Or10b1 G A 10: 78,355,609 (GRCm39) V56M probably benign Het
Parp8 C T 13: 117,029,562 (GRCm39) V554M probably damaging Het
Phpt1 A T 2: 25,464,750 (GRCm39) D34E probably benign Het
Ppip5k2 G A 1: 97,672,921 (GRCm39) S463L probably benign Het
Prss28 A G 17: 25,530,215 (GRCm39) Q173R probably benign Het
Rtel1 T A 2: 180,988,860 (GRCm39) W441R possibly damaging Het
Serbp1 T C 6: 67,244,025 (GRCm39) probably benign Het
Skint5 T C 4: 113,347,848 (GRCm39) K1319E unknown Het
Slc35a4 G A 18: 36,816,111 (GRCm39) G314S probably damaging Het
Slc8a1 A G 17: 81,956,498 (GRCm39) I180T probably damaging Het
Spire1 G A 18: 67,652,462 (GRCm39) P205L probably benign Het
Tat G T 8: 110,720,547 (GRCm39) G168W probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Trh C T 6: 92,219,939 (GRCm39) G126R probably benign Het
Ugcg G A 4: 59,207,843 (GRCm39) G61R probably damaging Het
Uggt1 T C 1: 36,260,306 (GRCm39) T170A probably benign Het
Unc5b G A 10: 60,608,028 (GRCm39) P702S probably damaging Het
Usp8 A G 2: 126,562,073 (GRCm39) D89G possibly damaging Het
Vmn2r1 T A 3: 64,012,674 (GRCm39) I845K probably damaging Het
Vnn3 A G 10: 23,740,498 (GRCm39) N267S possibly damaging Het
Xkr9 A G 1: 13,771,587 (GRCm39) R368G possibly damaging Het
Other mutations in Nyap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Nyap1 APN 5 137,736,346 (GRCm39) missense probably damaging 1.00
IGL02211:Nyap1 APN 5 137,737,937 (GRCm39) missense probably damaging 0.99
IGL02658:Nyap1 APN 5 137,733,746 (GRCm39) missense probably damaging 0.99
IGL03493:Nyap1 APN 5 137,733,278 (GRCm39) missense probably damaging 1.00
R0180:Nyap1 UTSW 5 137,736,283 (GRCm39) missense probably damaging 1.00
R0731:Nyap1 UTSW 5 137,733,560 (GRCm39) missense probably damaging 1.00
R1215:Nyap1 UTSW 5 137,733,395 (GRCm39) nonsense probably null
R1741:Nyap1 UTSW 5 137,731,387 (GRCm39) missense probably damaging 1.00
R1953:Nyap1 UTSW 5 137,733,294 (GRCm39) missense probably benign 0.01
R2006:Nyap1 UTSW 5 137,733,953 (GRCm39) missense possibly damaging 0.81
R2131:Nyap1 UTSW 5 137,731,943 (GRCm39) intron probably null
R2244:Nyap1 UTSW 5 137,733,576 (GRCm39) missense probably damaging 1.00
R4581:Nyap1 UTSW 5 137,734,284 (GRCm39) missense probably damaging 1.00
R4857:Nyap1 UTSW 5 137,733,840 (GRCm39) missense probably damaging 0.98
R5151:Nyap1 UTSW 5 137,734,376 (GRCm39) missense probably damaging 0.99
R5533:Nyap1 UTSW 5 137,733,726 (GRCm39) missense probably benign 0.15
R5695:Nyap1 UTSW 5 137,733,246 (GRCm39) missense probably damaging 1.00
R7201:Nyap1 UTSW 5 137,734,524 (GRCm39) missense probably damaging 1.00
R7210:Nyap1 UTSW 5 137,736,244 (GRCm39) missense probably damaging 1.00
R7374:Nyap1 UTSW 5 137,733,791 (GRCm39) missense probably damaging 1.00
R7434:Nyap1 UTSW 5 137,734,530 (GRCm39) missense probably damaging 1.00
R7658:Nyap1 UTSW 5 137,731,236 (GRCm39) missense probably benign
R7870:Nyap1 UTSW 5 137,733,658 (GRCm39) nonsense probably null
R7913:Nyap1 UTSW 5 137,733,231 (GRCm39) missense probably damaging 1.00
R8278:Nyap1 UTSW 5 137,730,077 (GRCm39) missense probably damaging 1.00
R8422:Nyap1 UTSW 5 137,734,083 (GRCm39) missense probably benign 0.01
R9145:Nyap1 UTSW 5 137,736,175 (GRCm39) missense probably benign
R9367:Nyap1 UTSW 5 137,734,248 (GRCm39) missense probably damaging 1.00
R9568:Nyap1 UTSW 5 137,733,394 (GRCm39) nonsense probably null
R9680:Nyap1 UTSW 5 137,733,840 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGGCCTGTAGATTCTAAATATGCCC -3'
(R):5'- AACTGGAGGTTCCCTGACTC -3'

Sequencing Primer
(F):5'- CCCCTTCAATATTTACCCCAACC -3'
(R):5'- ACAGCAGCTGGGCTCAAG -3'
Posted On 2022-06-15