Incidental Mutation 'R9441:Kndc1'
ID 713646
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, 2410012C07Rik, very-kind, VKIND
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9441 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 139894696-139941537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 139921476 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 894 (D894N)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
AlphaFold Q0KK55
Predicted Effect probably damaging
Transcript: ENSMUST00000053445
AA Change: D894N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: D894N

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik C A 9: 56,010,492 G20V unknown Het
Adam22 T C 5: 8,111,974 T733A possibly damaging Het
Adam28 T A 14: 68,637,494 N245Y probably damaging Het
Aldh9a1 C G 1: 167,350,350 R39G probably benign Het
Armc3 A C 2: 19,248,615 E189A possibly damaging Het
Atg9a C T 1: 75,186,442 C338Y possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cars G A 7: 143,569,448 T560I probably benign Het
Casp8ap2 A G 4: 32,645,873 K1649E probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cd84 G A 1: 171,886,427 probably null Het
Ces2g G T 8: 104,963,991 A135S possibly damaging Het
Cfh T C 1: 140,102,411 D926G probably benign Het
Chrm2 A G 6: 36,524,020 T271A probably benign Het
Col6a3 G T 1: 90,777,527 Y2824* probably null Het
Cth T A 3: 157,910,938 R196S probably damaging Het
Cyp2g1 T C 7: 26,814,635 M222T possibly damaging Het
Depdc5 T A 5: 32,937,698 M773K probably benign Het
Dmbx1 G A 4: 115,923,687 P39L probably damaging Het
Dst G C 1: 34,199,351 W1697C probably damaging Het
E330017A01Rik G A 16: 58,638,521 probably benign Het
Eno1 C T 4: 150,236,751 probably benign Het
Erc2 G T 14: 28,080,157 V761L possibly damaging Het
Frem1 A T 4: 83,005,846 I292N probably damaging Het
Hip1 G T 5: 135,431,717 L530M possibly damaging Het
Kcna2 A G 3: 107,104,952 Q283R probably benign Het
Lats1 G T 10: 7,702,917 G602W probably damaging Het
Lgals12 A G 19: 7,603,991 L117P probably damaging Het
Mfsd4b1 A T 10: 40,002,684 L406I possibly damaging Het
Msln A T 17: 25,750,757 M333K probably benign Het
Mup2 A G 4: 60,139,740 V16A probably benign Het
Mybpc2 T C 7: 44,516,906 E220G probably null Het
Myh6 A G 14: 54,960,314 Y456H probably benign Het
Nlrp1a A G 11: 71,123,108 S439P probably damaging Het
Nyap1 T C 5: 137,734,932 E613G probably benign Het
Olfr1358 G A 10: 78,519,775 V56M probably benign Het
Parp8 C T 13: 116,893,026 V554M probably damaging Het
Phpt1 A T 2: 25,574,738 D34E probably benign Het
Ppip5k2 G A 1: 97,745,196 S463L probably benign Het
Prss28 A G 17: 25,311,241 Q173R probably benign Het
Rtel1 T A 2: 181,347,067 W441R possibly damaging Het
Serbp1 T C 6: 67,267,041 probably benign Het
Skint5 T C 4: 113,490,651 K1319E unknown Het
Slc35a4 G A 18: 36,683,058 G314S probably damaging Het
Slc8a1 A G 17: 81,649,069 I180T probably damaging Het
Spire1 G A 18: 67,519,392 P205L probably benign Het
Tat G T 8: 109,993,915 G168W probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Trh C T 6: 92,242,958 G126R probably benign Het
Ugcg G A 4: 59,207,843 G61R probably damaging Het
Uggt1 T C 1: 36,221,225 T170A probably benign Het
Unc5b G A 10: 60,772,249 P702S probably damaging Het
Usp8 A G 2: 126,720,153 D89G possibly damaging Het
Vmn2r1 T A 3: 64,105,253 I845K probably damaging Het
Vnn3 A G 10: 23,864,600 N267S possibly damaging Het
Xkr9 A G 1: 13,701,363 R368G possibly damaging Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139901988 splice site probably benign
IGL01061:Kndc1 APN 7 139922694 missense probably benign 0.00
IGL01099:Kndc1 APN 7 139920784 missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139913972 splice site probably benign
IGL01767:Kndc1 APN 7 139930046 missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139914194 missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139923790 missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139920767 missense probably benign 0.19
IGL02411:Kndc1 APN 7 139921913 critical splice donor site probably null
IGL02472:Kndc1 APN 7 139910901 missense probably benign 0.01
IGL02537:Kndc1 APN 7 139910410 missense probably benign 0.01
IGL02708:Kndc1 APN 7 139901181 missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139921509 missense probably benign 0.28
IGL03160:Kndc1 APN 7 139920689 nonsense probably null
IGL03138:Kndc1 UTSW 7 139939878 missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139923776 frame shift probably null
PIT4696001:Kndc1 UTSW 7 139932917 missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139910304 missense probably benign 0.00
R0384:Kndc1 UTSW 7 139910599 missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139930124 missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139908996 missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139914023 missense probably null 0.19
R0530:Kndc1 UTSW 7 139901237 missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139923735 missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139922684 missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139927408 missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139930756 missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139927711 missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139921280 missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139930761 missense probably benign 0.02
R2103:Kndc1 UTSW 7 139921234 missense probably benign 0.01
R2128:Kndc1 UTSW 7 139930112 missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139921822 missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139901207 missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139902060 splice site probably benign
R3747:Kndc1 UTSW 7 139927904 critical splice donor site probably null
R3848:Kndc1 UTSW 7 139908977 missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139930028 missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4044:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4095:Kndc1 UTSW 7 139937025 missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139910882 missense probably benign 0.01
R4478:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139910286 missense probably benign 0.00
R4540:Kndc1 UTSW 7 139921427 nonsense probably null
R4584:Kndc1 UTSW 7 139901243 missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139921779 missense probably benign 0.02
R4705:Kndc1 UTSW 7 139930123 missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139924031 nonsense probably null
R4859:Kndc1 UTSW 7 139921905 missense probably benign 0.03
R5004:Kndc1 UTSW 7 139932879 nonsense probably null
R5037:Kndc1 UTSW 7 139910455 missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139936809 missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139908962 missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139931889 missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139927891 missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139924111 missense probably benign 0.00
R5888:Kndc1 UTSW 7 139895217 missense probably benign 0.00
R5942:Kndc1 UTSW 7 139936879 missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139939827 missense probably benign 0.05
R5990:Kndc1 UTSW 7 139927420 missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139923775 frame shift probably null
R6076:Kndc1 UTSW 7 139902038 missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139923802 missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139921213 missense probably benign 0.04
R6276:Kndc1 UTSW 7 139921063 missense probably benign
R6367:Kndc1 UTSW 7 139913506 missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139922751 critical splice donor site probably null
R6745:Kndc1 UTSW 7 139920976 missense probably benign 0.02
R6886:Kndc1 UTSW 7 139913569 missense probably benign 0.01
R6912:Kndc1 UTSW 7 139910278 missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139921828 missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139936836 missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139931860 missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139920783 missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139909043 missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139920696 missense probably benign 0.01
R7570:Kndc1 UTSW 7 139923775 frame shift probably null
R7625:Kndc1 UTSW 7 139938017 missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139895260 missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139939838 missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139923816 missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139920964 missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139921486 missense probably benign 0.02
R8011:Kndc1 UTSW 7 139910620 missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139918844 missense probably benign 0.01
R8134:Kndc1 UTSW 7 139901369 splice site probably null
R8197:Kndc1 UTSW 7 139913531 missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139924045 missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139913518 missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139913518 missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139901205 missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139923753 missense probably benign 0.27
R8735:Kndc1 UTSW 7 139910214 missense probably benign 0.00
R8816:Kndc1 UTSW 7 139937996 missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139924061 missense possibly damaging 0.95
R8961:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9002:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139921441 missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139895224 missense possibly damaging 0.55
R9476:Kndc1 UTSW 7 139930118 missense probably benign 0.00
R9510:Kndc1 UTSW 7 139930118 missense probably benign 0.00
R9518:Kndc1 UTSW 7 139939914 missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139920704 missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139921912 missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139910813 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTCGACACCCATGTAAGCC -3'
(R):5'- AAGCTGTCTCAGGACTTTGGG -3'

Sequencing Primer
(F):5'- ATGTAAGCCACCCAGGGG -3'
(R):5'- TCAAGTTGGAAGCTGCCCTG -3'
Posted On 2022-06-15