Incidental Mutation 'R9441:Parp8'
ID 713658
Institutional Source Beutler Lab
Gene Symbol Parp8
Ensembl Gene ENSMUSG00000021725
Gene Name poly (ADP-ribose) polymerase family, member 8
Synonyms D13Ertd275e, 2810430O08Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9441 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 116991356-117162073 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 117029562 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 554 (V554M)
Ref Sequence ENSEMBL: ENSMUSP00000022239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022239] [ENSMUST00000223949] [ENSMUST00000225344] [ENSMUST00000226107]
AlphaFold Q3UD82
Predicted Effect probably damaging
Transcript: ENSMUST00000022239
AA Change: V554M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022239
Gene: ENSMUSG00000021725
AA Change: V554M

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
internal_repeat_1 332 410 4.61e-10 PROSPERO
internal_repeat_1 404 476 4.61e-10 PROSPERO
low complexity region 497 514 N/A INTRINSIC
Pfam:PARP 712 839 2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223949
AA Change: V515M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000225344
Predicted Effect probably benign
Transcript: ENSMUST00000226107
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik C A 9: 55,917,776 (GRCm39) G20V unknown Het
Adam22 T C 5: 8,161,974 (GRCm39) T733A possibly damaging Het
Adam28 T A 14: 68,874,943 (GRCm39) N245Y probably damaging Het
Aldh9a1 C G 1: 167,177,919 (GRCm39) R39G probably benign Het
Armc3 A C 2: 19,253,426 (GRCm39) E189A possibly damaging Het
Atg9a C T 1: 75,163,086 (GRCm39) C338Y possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,128,173 (GRCm39) probably benign Het
Cars1 G A 7: 143,123,185 (GRCm39) T560I probably benign Het
Casp8ap2 A G 4: 32,645,873 (GRCm39) K1649E probably benign Het
Ccdc88b T C 19: 6,833,213 (GRCm39) E278G probably damaging Het
Cd84 G A 1: 171,713,994 (GRCm39) probably null Het
Ces2g G T 8: 105,690,623 (GRCm39) A135S possibly damaging Het
Cfh T C 1: 140,030,149 (GRCm39) D926G probably benign Het
Chrm2 A G 6: 36,500,955 (GRCm39) T271A probably benign Het
Col6a3 G T 1: 90,705,249 (GRCm39) Y2824* probably null Het
Cth T A 3: 157,616,575 (GRCm39) R196S probably damaging Het
Cyp2g1 T C 7: 26,514,060 (GRCm39) M222T possibly damaging Het
Depdc5 T A 5: 33,095,042 (GRCm39) M773K probably benign Het
Dmbx1 G A 4: 115,780,884 (GRCm39) P39L probably damaging Het
Dst G C 1: 34,238,432 (GRCm39) W1697C probably damaging Het
Eno1 C T 4: 150,321,208 (GRCm39) probably benign Het
Erc2 G T 14: 27,802,114 (GRCm39) V761L possibly damaging Het
Frem1 A T 4: 82,924,083 (GRCm39) I292N probably damaging Het
Ftdc2 G A 16: 58,458,884 (GRCm39) probably benign Het
Hip1 G T 5: 135,460,571 (GRCm39) L530M possibly damaging Het
Kcna2 A G 3: 107,012,268 (GRCm39) Q283R probably benign Het
Kndc1 G A 7: 139,501,392 (GRCm39) D894N probably damaging Het
Lats1 G T 10: 7,578,681 (GRCm39) G602W probably damaging Het
Lgals12 A G 19: 7,581,356 (GRCm39) L117P probably damaging Het
Mfsd4b1 A T 10: 39,878,680 (GRCm39) L406I possibly damaging Het
Msln A T 17: 25,969,731 (GRCm39) M333K probably benign Het
Mup2 A G 4: 60,139,740 (GRCm39) V16A probably benign Het
Mybpc2 T C 7: 44,166,330 (GRCm39) E220G probably null Het
Myh6 A G 14: 55,197,771 (GRCm39) Y456H probably benign Het
Nlrp1a A G 11: 71,013,934 (GRCm39) S439P probably damaging Het
Nyap1 T C 5: 137,733,194 (GRCm39) E613G probably benign Het
Or10b1 G A 10: 78,355,609 (GRCm39) V56M probably benign Het
Phpt1 A T 2: 25,464,750 (GRCm39) D34E probably benign Het
Ppip5k2 G A 1: 97,672,921 (GRCm39) S463L probably benign Het
Prss28 A G 17: 25,530,215 (GRCm39) Q173R probably benign Het
Rtel1 T A 2: 180,988,860 (GRCm39) W441R possibly damaging Het
Serbp1 T C 6: 67,244,025 (GRCm39) probably benign Het
Skint5 T C 4: 113,347,848 (GRCm39) K1319E unknown Het
Slc35a4 G A 18: 36,816,111 (GRCm39) G314S probably damaging Het
Slc8a1 A G 17: 81,956,498 (GRCm39) I180T probably damaging Het
Spire1 G A 18: 67,652,462 (GRCm39) P205L probably benign Het
Tat G T 8: 110,720,547 (GRCm39) G168W probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Trh C T 6: 92,219,939 (GRCm39) G126R probably benign Het
Ugcg G A 4: 59,207,843 (GRCm39) G61R probably damaging Het
Uggt1 T C 1: 36,260,306 (GRCm39) T170A probably benign Het
Unc5b G A 10: 60,608,028 (GRCm39) P702S probably damaging Het
Usp8 A G 2: 126,562,073 (GRCm39) D89G possibly damaging Het
Vmn2r1 T A 3: 64,012,674 (GRCm39) I845K probably damaging Het
Vnn3 A G 10: 23,740,498 (GRCm39) N267S possibly damaging Het
Xkr9 A G 1: 13,771,587 (GRCm39) R368G possibly damaging Het
Other mutations in Parp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Parp8 APN 13 117,063,859 (GRCm39) missense probably damaging 1.00
IGL01346:Parp8 APN 13 117,031,600 (GRCm39) missense possibly damaging 0.72
IGL01793:Parp8 APN 13 117,047,415 (GRCm39) missense probably damaging 1.00
IGL01926:Parp8 APN 13 116,998,838 (GRCm39) splice site probably benign
IGL01958:Parp8 APN 13 117,013,108 (GRCm39) missense probably benign 0.14
IGL02131:Parp8 APN 13 117,047,409 (GRCm39) missense probably benign 0.08
IGL02398:Parp8 APN 13 117,047,399 (GRCm39) critical splice donor site probably null
IGL02496:Parp8 APN 13 116,998,838 (GRCm39) splice site probably benign
IGL03135:Parp8 APN 13 117,047,478 (GRCm39) missense probably benign 0.41
IGL03143:Parp8 APN 13 117,047,497 (GRCm39) splice site probably benign
IGL03201:Parp8 APN 13 116,999,605 (GRCm39) splice site probably benign
blondi UTSW 13 117,029,577 (GRCm39) missense possibly damaging 0.77
Heidi UTSW 13 116,998,740 (GRCm39) splice site probably null
R0362:Parp8 UTSW 13 117,061,504 (GRCm39) nonsense probably null
R0699:Parp8 UTSW 13 117,059,120 (GRCm39) missense probably benign 0.01
R1445:Parp8 UTSW 13 117,161,886 (GRCm39) splice site probably null
R1676:Parp8 UTSW 13 117,014,064 (GRCm39) missense probably damaging 0.99
R1977:Parp8 UTSW 13 117,047,449 (GRCm39) missense probably damaging 0.96
R2019:Parp8 UTSW 13 117,004,968 (GRCm39) splice site probably benign
R2049:Parp8 UTSW 13 117,031,422 (GRCm39) missense probably benign 0.20
R2142:Parp8 UTSW 13 117,031,422 (GRCm39) missense probably benign 0.20
R2474:Parp8 UTSW 13 117,029,577 (GRCm39) missense possibly damaging 0.77
R2566:Parp8 UTSW 13 117,032,223 (GRCm39) missense possibly damaging 0.78
R3863:Parp8 UTSW 13 117,031,303 (GRCm39) missense probably benign 0.01
R4126:Parp8 UTSW 13 117,005,005 (GRCm39) missense possibly damaging 0.94
R4518:Parp8 UTSW 13 117,032,209 (GRCm39) missense possibly damaging 0.62
R4519:Parp8 UTSW 13 117,032,209 (GRCm39) missense possibly damaging 0.62
R4767:Parp8 UTSW 13 117,005,072 (GRCm39) missense probably damaging 0.99
R5355:Parp8 UTSW 13 116,998,740 (GRCm39) splice site probably null
R5633:Parp8 UTSW 13 117,013,116 (GRCm39) missense probably damaging 1.00
R5942:Parp8 UTSW 13 117,005,969 (GRCm39) missense probably benign 0.12
R5978:Parp8 UTSW 13 117,032,268 (GRCm39) missense probably benign 0.01
R6039:Parp8 UTSW 13 117,014,134 (GRCm39) missense probably damaging 1.00
R6039:Parp8 UTSW 13 117,014,134 (GRCm39) missense probably damaging 1.00
R6753:Parp8 UTSW 13 117,031,651 (GRCm39) missense possibly damaging 0.91
R7016:Parp8 UTSW 13 117,031,627 (GRCm39) missense probably damaging 1.00
R7139:Parp8 UTSW 13 117,161,802 (GRCm39) missense probably benign 0.21
R7305:Parp8 UTSW 13 117,031,461 (GRCm39) missense possibly damaging 0.95
R7314:Parp8 UTSW 13 117,004,996 (GRCm39) missense probably benign 0.01
R7360:Parp8 UTSW 13 117,032,307 (GRCm39) missense probably benign 0.02
R7526:Parp8 UTSW 13 117,031,341 (GRCm39) missense probably damaging 1.00
R8078:Parp8 UTSW 13 117,061,519 (GRCm39) missense probably damaging 1.00
R8108:Parp8 UTSW 13 117,003,609 (GRCm39) nonsense probably null
R8372:Parp8 UTSW 13 116,991,786 (GRCm39) missense probably damaging 1.00
R9005:Parp8 UTSW 13 117,013,126 (GRCm39) missense probably benign
R9072:Parp8 UTSW 13 117,047,951 (GRCm39) missense probably damaging 1.00
R9073:Parp8 UTSW 13 117,047,951 (GRCm39) missense probably damaging 1.00
R9351:Parp8 UTSW 13 117,000,781 (GRCm39) missense probably damaging 0.99
R9448:Parp8 UTSW 13 117,039,360 (GRCm39) nonsense probably null
R9470:Parp8 UTSW 13 117,031,292 (GRCm39) missense probably benign 0.02
R9562:Parp8 UTSW 13 117,029,631 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CGGAAGTCATATTAATGCCTTTCC -3'
(R):5'- AGCATTCCAATCCGAGACCG -3'

Sequencing Primer
(F):5'- GCCTTTCCATGCAAATGATAGC -3'
(R):5'- GCGGCTTCCTGGTGCAG -3'
Posted On 2022-06-15