Incidental Mutation 'R9442:Psg18'
ID 713681
Institutional Source Beutler Lab
Gene Symbol Psg18
Ensembl Gene ENSMUSG00000003505
Gene Name pregnancy specific glycoprotein 18
Synonyms Cea-3, Cea3, mmCGM6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R9442 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 18345422-18355009 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 18349260 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 323 (Y323*)
Ref Sequence ENSEMBL: ENSMUSP00000003597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003597] [ENSMUST00000098783]
AlphaFold B2RSG7
Predicted Effect probably null
Transcript: ENSMUST00000003597
AA Change: Y323*
SMART Domains Protein: ENSMUSP00000003597
Gene: ENSMUSG00000003505
AA Change: Y323*

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
IG 40 140 2.11e-2 SMART
IG 161 262 1.03e0 SMART
IG 281 380 2.15e-3 SMART
IGc2 398 462 1.58e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000098783
AA Change: Y202*
SMART Domains Protein: ENSMUSP00000096380
Gene: ENSMUSG00000003505
AA Change: Y202*

DomainStartEndE-ValueType
IG 40 141 1.03e0 SMART
IG 160 259 2.15e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182983
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T A 17: 48,036,771 K241N possibly damaging Het
Adam5 A T 8: 24,806,494 S312R probably damaging Het
Atg9a C T 1: 75,186,442 C338Y possibly damaging Het
Cage1 T C 13: 38,012,471 E749G possibly damaging Het
Catspere2 C A 1: 178,103,709 T398K unknown Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Ccndbp1 T C 2: 121,008,532 V8A probably benign Het
Cenpt T C 8: 105,848,786 D228G probably benign Het
Cfap57 A G 4: 118,606,534 probably null Het
Cyp4a32 T A 4: 115,611,225 N301K probably benign Het
Epha6 T C 16: 60,205,487 T531A probably benign Het
Gmeb1 A T 4: 132,234,845 C168S probably damaging Het
H2-DMa G A 17: 34,138,158 R210H possibly damaging Het
Ighv1-7 T G 12: 114,538,578 T90P probably damaging Het
Kalrn A C 16: 34,095,879 M1R probably null Het
Kcnrg CACAACAA CACAA 14: 61,607,560 probably benign Het
Krtap14 T C 16: 88,825,977 D38G possibly damaging Het
Lrrc8e A G 8: 4,233,964 N63S probably benign Het
Map4k2 T A 19: 6,342,784 L152Q probably damaging Het
Mcf2l A G 8: 12,973,048 D78G possibly damaging Het
Ms4a6c T C 19: 11,472,487 V81A probably benign Het
Mtnr1b T C 9: 15,874,364 T33A probably benign Het
Muc16 T A 9: 18,655,328 Q1965L unknown Het
Nlrp9b C T 7: 20,045,782 T790I possibly damaging Het
Nol4 A T 18: 22,769,842 C371S probably damaging Het
Olfr114 A G 17: 37,589,742 S204P possibly damaging Het
Orc1 T C 4: 108,612,160 V727A probably benign Het
Phf20l1 C T 15: 66,613,039 Q318* probably null Het
Ptk2b T C 14: 66,171,740 Y529C probably damaging Het
Rrm1 A G 7: 102,459,391 Y374C probably damaging Het
Selp T A 1: 164,137,196 F476I probably damaging Het
Sema3b A G 9: 107,601,758 probably null Het
Setdb2 T G 14: 59,402,400 T665P probably damaging Het
Sorbs3 T C 14: 70,186,938 Y515C probably damaging Het
St13 G A 15: 81,388,374 P90S possibly damaging Het
Stag1 T A 9: 100,954,253 I1197N probably damaging Het
Svs3a A G 2: 164,290,259 Y250C probably damaging Het
Ticam1 T C 17: 56,270,428 I556V probably benign Het
Vmn1r180 A G 7: 23,952,195 probably benign Het
Xirp2 T A 2: 67,511,891 L1492* probably null Het
Zfp438 A G 18: 5,214,379 V193A probably benign Het
Zfp729b A G 13: 67,591,218 V976A probably benign Het
Other mutations in Psg18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Psg18 APN 7 18354816 start codon destroyed probably null 0.99
IGL01748:Psg18 APN 7 18353551 missense probably benign 0.05
IGL01767:Psg18 APN 7 18353397 missense possibly damaging 0.80
IGL02727:Psg18 APN 7 18345950 missense probably damaging 1.00
IGL02744:Psg18 APN 7 18349402 missense probably benign 0.38
G1Funyon:Psg18 UTSW 7 18353377 missense probably damaging 0.99
PIT4466001:Psg18 UTSW 7 18349316 missense probably benign 0.30
R0331:Psg18 UTSW 7 18353308 missense probably benign 0.03
R1077:Psg18 UTSW 7 18351075 missense possibly damaging 0.84
R1171:Psg18 UTSW 7 18346079 missense probably benign 0.10
R1173:Psg18 UTSW 7 18354817 start codon destroyed probably null 0.97
R1234:Psg18 UTSW 7 18349190 missense probably damaging 1.00
R1553:Psg18 UTSW 7 18353481 missense probably benign 0.19
R1632:Psg18 UTSW 7 18350899 missense probably benign 0.02
R2108:Psg18 UTSW 7 18350874 missense probably damaging 1.00
R2439:Psg18 UTSW 7 18346119 missense probably benign 0.24
R3032:Psg18 UTSW 7 18350979 missense probably benign 0.01
R3053:Psg18 UTSW 7 18349193 missense probably damaging 1.00
R3432:Psg18 UTSW 7 18349171 missense possibly damaging 0.61
R3725:Psg18 UTSW 7 18354823 start gained probably benign
R4479:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4480:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4846:Psg18 UTSW 7 18350786 nonsense probably null
R4858:Psg18 UTSW 7 18353484 missense possibly damaging 0.49
R5010:Psg18 UTSW 7 18349354 missense probably damaging 1.00
R5225:Psg18 UTSW 7 18345949 missense probably damaging 1.00
R5450:Psg18 UTSW 7 18353425 missense probably benign 0.32
R5526:Psg18 UTSW 7 18349348 missense probably damaging 1.00
R5840:Psg18 UTSW 7 18346602 intron probably benign
R6409:Psg18 UTSW 7 18353521 missense probably benign
R7164:Psg18 UTSW 7 18350937 missense possibly damaging 0.89
R7276:Psg18 UTSW 7 18345984 missense probably damaging 0.99
R7768:Psg18 UTSW 7 18346028 missense probably damaging 1.00
R8301:Psg18 UTSW 7 18353377 missense probably damaging 0.99
R8700:Psg18 UTSW 7 18353625 missense probably damaging 1.00
R8982:Psg18 UTSW 7 18349375 missense probably benign 0.20
R9042:Psg18 UTSW 7 18349122 missense probably benign 0.44
R9054:Psg18 UTSW 7 18353525 missense possibly damaging 0.82
R9538:Psg18 UTSW 7 18350788 missense probably benign 0.01
Z1176:Psg18 UTSW 7 18354787 missense probably benign 0.07
Z1177:Psg18 UTSW 7 18349115 missense probably benign 0.30
Z1177:Psg18 UTSW 7 18349198 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TAAGCCACACCCAGCAGTTG -3'
(R):5'- GCAGGTCACCATCTTTCCAC -3'

Sequencing Primer
(F):5'- TTGGAAGCCATAGAGAGTCACTTAC -3'
(R):5'- ACCTAGCACAATGATCCCTTCTG -3'
Posted On 2022-06-15