Incidental Mutation 'R9442:Vmn1r180'
ID 713683
Institutional Source Beutler Lab
Gene Symbol Vmn1r180
Ensembl Gene ENSMUSG00000092473
Gene Name vomeronasal 1 receptor 180
Synonyms LOC232962, V1rd16
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9442 (G1)
Quality Score 92.0077
Status Validated
Chromosome 7
Chromosomal Location 23950632-23955691 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) A to G at 23952195 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173816]
AlphaFold B9EK86
Predicted Effect probably benign
Transcript: ENSMUST00000173816
SMART Domains Protein: ENSMUSP00000134362
Gene: ENSMUSG00000092473

DomainStartEndE-ValueType
Pfam:TAS2R 8 298 2.9e-15 PFAM
Pfam:7tm_1 31 286 6.7e-9 PFAM
Pfam:V1R 41 297 1.4e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T A 17: 48,036,771 K241N possibly damaging Het
Adam5 A T 8: 24,806,494 S312R probably damaging Het
Atg9a C T 1: 75,186,442 C338Y possibly damaging Het
Cage1 T C 13: 38,012,471 E749G possibly damaging Het
Catspere2 C A 1: 178,103,709 T398K unknown Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Ccndbp1 T C 2: 121,008,532 V8A probably benign Het
Cenpt T C 8: 105,848,786 D228G probably benign Het
Cfap57 A G 4: 118,606,534 probably null Het
Cyp4a32 T A 4: 115,611,225 N301K probably benign Het
Epha6 T C 16: 60,205,487 T531A probably benign Het
Gmeb1 A T 4: 132,234,845 C168S probably damaging Het
H2-DMa G A 17: 34,138,158 R210H possibly damaging Het
Ighv1-7 T G 12: 114,538,578 T90P probably damaging Het
Kalrn A C 16: 34,095,879 M1R probably null Het
Kcnrg CACAACAA CACAA 14: 61,607,560 probably benign Het
Krtap14 T C 16: 88,825,977 D38G possibly damaging Het
Lrrc8e A G 8: 4,233,964 N63S probably benign Het
Map4k2 T A 19: 6,342,784 L152Q probably damaging Het
Mcf2l A G 8: 12,973,048 D78G possibly damaging Het
Ms4a6c T C 19: 11,472,487 V81A probably benign Het
Mtnr1b T C 9: 15,874,364 T33A probably benign Het
Muc16 T A 9: 18,655,328 Q1965L unknown Het
Nfatc2 A C 2: 168,486,978 probably benign Het
Nlrp9b C T 7: 20,045,782 T790I possibly damaging Het
Nol4 A T 18: 22,769,842 C371S probably damaging Het
Ntn1 A C 11: 68,257,659 probably benign Het
Olfr114 A G 17: 37,589,742 S204P possibly damaging Het
Orc1 T C 4: 108,612,160 V727A probably benign Het
Phf20l1 C T 15: 66,613,039 Q318* probably null Het
Psg18 A T 7: 18,349,260 Y323* probably null Het
Ptk2b T C 14: 66,171,740 Y529C probably damaging Het
Rrm1 A G 7: 102,459,391 Y374C probably damaging Het
Selp T A 1: 164,137,196 F476I probably damaging Het
Sema3b A G 9: 107,601,758 probably null Het
Setdb2 T G 14: 59,402,400 T665P probably damaging Het
Sorbs3 T C 14: 70,186,938 Y515C probably damaging Het
St13 G A 15: 81,388,374 P90S possibly damaging Het
Stag1 T A 9: 100,954,253 I1197N probably damaging Het
Svs3a A G 2: 164,290,259 Y250C probably damaging Het
Ticam1 T C 17: 56,270,428 I556V probably benign Het
Xirp2 T A 2: 67,511,891 L1492* probably null Het
Zfp438 A G 18: 5,214,379 V193A probably benign Het
Zfp729b A G 13: 67,591,218 V976A probably benign Het
Other mutations in Vmn1r180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Vmn1r180 APN 7 23952523 missense probably benign 0.36
IGL01309:Vmn1r180 APN 7 23952999 missense probably damaging 1.00
IGL01793:Vmn1r180 APN 7 23953243 missense probably benign 0.00
IGL02653:Vmn1r180 APN 7 23953075 missense probably damaging 1.00
IGL03277:Vmn1r180 APN 7 23953285 missense probably damaging 0.99
IGL03352:Vmn1r180 APN 7 23952652 nonsense probably null
R1298:Vmn1r180 UTSW 7 23953147 missense possibly damaging 0.84
R1701:Vmn1r180 UTSW 7 23952970 missense possibly damaging 0.84
R1702:Vmn1r180 UTSW 7 23952969 missense possibly damaging 0.52
R2122:Vmn1r180 UTSW 7 23953141 missense probably damaging 1.00
R4241:Vmn1r180 UTSW 7 23952873 missense probably damaging 1.00
R5683:Vmn1r180 UTSW 7 23953210 missense possibly damaging 0.58
R7241:Vmn1r180 UTSW 7 23952466 missense probably damaging 0.96
R7522:Vmn1r180 UTSW 7 23953260 missense probably damaging 1.00
R8749:Vmn1r180 UTSW 7 23952990 missense probably damaging 1.00
R8991:Vmn1r180 UTSW 7 23952651 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGAATCTCTAACTTGTTACTGATTACG -3'
(R):5'- AACTTTACCTGACCCTGGGG -3'

Sequencing Primer
(F):5'- ACATGCCTTTGCAGTCTT -3'
(R):5'- CCCTGGGGTAATGATTAGGTTGAAC -3'
Posted On 2022-06-15