Incidental Mutation 'R9442:Rrm1'
ID 713684
Institutional Source Beutler Lab
Gene Symbol Rrm1
Ensembl Gene ENSMUSG00000030978
Gene Name ribonucleotide reductase M1
Synonyms RnrM1
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.970) question?
Stock # R9442 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 102090902-102118978 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102108598 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 374 (Y374C)
Ref Sequence ENSEMBL: ENSMUSP00000033283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033283] [ENSMUST00000209630]
AlphaFold P07742
Predicted Effect probably damaging
Transcript: ENSMUST00000033283
AA Change: Y374C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033283
Gene: ENSMUSG00000030978
AA Change: Y374C

DomainStartEndE-ValueType
Pfam:ATP-cone 1 89 8.7e-21 PFAM
Pfam:Ribonuc_red_lgN 141 213 2.8e-25 PFAM
Pfam:Ribonuc_red_lgC 216 738 1.6e-197 PFAM
coiled coil region 749 778 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large and catalytic subunit of ribonucleotide reductase, an enzyme essential for the conversion of ribonucleotides into deoxyribonucleotides. A pool of available deoxyribonucleotides is important for DNA replication during S phase of the cell cycle as well as multiple DNA repair processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic letahlity before E3.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T A 17: 48,347,580 (GRCm39) K241N possibly damaging Het
Adam5 A T 8: 25,296,510 (GRCm39) S312R probably damaging Het
Atg9a C T 1: 75,163,086 (GRCm39) C338Y possibly damaging Het
Cage1 T C 13: 38,196,447 (GRCm39) E749G possibly damaging Het
Catspere2 C A 1: 177,931,275 (GRCm39) T398K unknown Het
Ccdc88b T C 19: 6,833,213 (GRCm39) E278G probably damaging Het
Ccndbp1 T C 2: 120,839,013 (GRCm39) V8A probably benign Het
Cenpt T C 8: 106,575,418 (GRCm39) D228G probably benign Het
Cfap57 A G 4: 118,463,731 (GRCm39) probably null Het
Cyp4a32 T A 4: 115,468,422 (GRCm39) N301K probably benign Het
Epha6 T C 16: 60,025,850 (GRCm39) T531A probably benign Het
Gmeb1 A T 4: 131,962,156 (GRCm39) C168S probably damaging Het
H2-DMa G A 17: 34,357,132 (GRCm39) R210H possibly damaging Het
Ighv1-7 T G 12: 114,502,198 (GRCm39) T90P probably damaging Het
Kalrn A C 16: 33,916,249 (GRCm39) M1R probably null Het
Kcnrg CACAACAA CACAA 14: 61,845,009 (GRCm39) probably benign Het
Krtap14 T C 16: 88,622,865 (GRCm39) D38G possibly damaging Het
Lrrc8e A G 8: 4,283,964 (GRCm39) N63S probably benign Het
Map4k2 T A 19: 6,392,814 (GRCm39) L152Q probably damaging Het
Mcf2l A G 8: 13,023,048 (GRCm39) D78G possibly damaging Het
Ms4a6c T C 19: 11,449,851 (GRCm39) V81A probably benign Het
Mtnr1b T C 9: 15,785,660 (GRCm39) T33A probably benign Het
Muc16 T A 9: 18,566,624 (GRCm39) Q1965L unknown Het
Nfatc2 A C 2: 168,328,898 (GRCm39) probably benign Het
Nlrp9b C T 7: 19,779,707 (GRCm39) T790I possibly damaging Het
Nol4 A T 18: 22,902,899 (GRCm39) C371S probably damaging Het
Ntn1 A C 11: 68,148,485 (GRCm39) probably benign Het
Or14j3 A G 17: 37,900,633 (GRCm39) S204P possibly damaging Het
Orc1 T C 4: 108,469,357 (GRCm39) V727A probably benign Het
Phf20l1 C T 15: 66,484,888 (GRCm39) Q318* probably null Het
Psg18 A T 7: 18,083,185 (GRCm39) Y323* probably null Het
Ptk2b T C 14: 66,409,189 (GRCm39) Y529C probably damaging Het
Selp T A 1: 163,964,765 (GRCm39) F476I probably damaging Het
Sema3b A G 9: 107,478,957 (GRCm39) probably null Het
Setdb2 T G 14: 59,639,849 (GRCm39) T665P probably damaging Het
Sorbs3 T C 14: 70,424,387 (GRCm39) Y515C probably damaging Het
St13 G A 15: 81,272,575 (GRCm39) P90S possibly damaging Het
Stag1 T A 9: 100,836,306 (GRCm39) I1197N probably damaging Het
Svs3a A G 2: 164,132,179 (GRCm39) Y250C probably damaging Het
Ticam1 T C 17: 56,577,428 (GRCm39) I556V probably benign Het
Vmn1r180 A G 7: 23,651,620 (GRCm39) probably benign Het
Xirp2 T A 2: 67,342,235 (GRCm39) L1492* probably null Het
Zfp438 A G 18: 5,214,379 (GRCm39) V193A probably benign Het
Zfp729b A G 13: 67,739,337 (GRCm39) V976A probably benign Het
Other mutations in Rrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rrm1 APN 7 102,103,714 (GRCm39) nonsense probably null
IGL01431:Rrm1 APN 7 102,106,759 (GRCm39) splice site probably benign
IGL03251:Rrm1 APN 7 102,106,413 (GRCm39) missense probably damaging 1.00
IGL03401:Rrm1 APN 7 102,114,951 (GRCm39) missense possibly damaging 0.81
Arabica UTSW 7 102,109,558 (GRCm39) missense probably damaging 1.00
Pentose UTSW 7 102,110,063 (GRCm39) splice site probably null
R0454:Rrm1 UTSW 7 102,116,133 (GRCm39) missense probably damaging 1.00
R0548:Rrm1 UTSW 7 102,116,274 (GRCm39) critical splice donor site probably null
R0759:Rrm1 UTSW 7 102,106,768 (GRCm39) missense probably benign 0.32
R1575:Rrm1 UTSW 7 102,105,721 (GRCm39) missense probably damaging 1.00
R1586:Rrm1 UTSW 7 102,116,112 (GRCm39) makesense probably null
R1625:Rrm1 UTSW 7 102,117,554 (GRCm39) missense probably damaging 0.98
R2207:Rrm1 UTSW 7 102,091,233 (GRCm39) start codon destroyed probably null 0.98
R2432:Rrm1 UTSW 7 102,092,279 (GRCm39) missense probably benign 0.03
R2513:Rrm1 UTSW 7 102,109,896 (GRCm39) missense probably damaging 0.99
R3796:Rrm1 UTSW 7 102,114,910 (GRCm39) splice site probably null
R3914:Rrm1 UTSW 7 102,106,381 (GRCm39) missense probably damaging 1.00
R4179:Rrm1 UTSW 7 102,106,405 (GRCm39) missense probably damaging 1.00
R4302:Rrm1 UTSW 7 102,097,031 (GRCm39) missense probably benign 0.00
R4379:Rrm1 UTSW 7 102,095,800 (GRCm39) missense probably damaging 1.00
R4416:Rrm1 UTSW 7 102,097,008 (GRCm39) missense probably benign 0.06
R4690:Rrm1 UTSW 7 102,097,086 (GRCm39) missense probably benign
R4939:Rrm1 UTSW 7 102,116,131 (GRCm39) missense probably benign 0.34
R5433:Rrm1 UTSW 7 102,114,974 (GRCm39) missense probably damaging 0.97
R5445:Rrm1 UTSW 7 102,100,230 (GRCm39) missense possibly damaging 0.77
R6120:Rrm1 UTSW 7 102,110,063 (GRCm39) splice site probably null
R6198:Rrm1 UTSW 7 102,095,936 (GRCm39) critical splice donor site probably null
R6369:Rrm1 UTSW 7 102,095,909 (GRCm39) missense probably damaging 0.97
R6699:Rrm1 UTSW 7 102,110,032 (GRCm39) missense probably damaging 1.00
R7009:Rrm1 UTSW 7 102,109,541 (GRCm39) missense probably damaging 1.00
R7491:Rrm1 UTSW 7 102,103,764 (GRCm39) missense probably damaging 1.00
R8024:Rrm1 UTSW 7 102,106,472 (GRCm39) missense probably benign 0.00
R8276:Rrm1 UTSW 7 102,110,059 (GRCm39) critical splice donor site probably null
R8713:Rrm1 UTSW 7 102,109,558 (GRCm39) missense probably damaging 1.00
R8963:Rrm1 UTSW 7 102,105,739 (GRCm39) missense probably benign 0.23
R8968:Rrm1 UTSW 7 102,117,545 (GRCm39) missense probably benign 0.03
R9028:Rrm1 UTSW 7 102,109,605 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCCTCACAACACTCATG -3'
(R):5'- TGTGCTAGGCAGTCAGTCTCTC -3'

Sequencing Primer
(F):5'- TCATGCACATATACTTAAACAGACAC -3'
(R):5'- ACTCTACTATTTCTGTACACAGGTTG -3'
Posted On 2022-06-15