Incidental Mutation 'R9442:Lrrc8e'
ID 713685
Institutional Source Beutler Lab
Gene Symbol Lrrc8e
Ensembl Gene ENSMUSG00000046589
Gene Name leucine rich repeat containing 8 family, member E
Synonyms 1810049O03Rik, C87354
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R9442 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 4276827-4287470 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4283964 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 63 (N63S)
Ref Sequence ENSEMBL: ENSMUSP00000052055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003027] [ENSMUST00000053035] [ENSMUST00000062686] [ENSMUST00000110998] [ENSMUST00000110999] [ENSMUST00000145165] [ENSMUST00000207770]
AlphaFold Q66JT1
Predicted Effect probably benign
Transcript: ENSMUST00000003027
SMART Domains Protein: ENSMUSP00000003027
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
low complexity region 435 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053035
AA Change: N63S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000052055
Gene: ENSMUSG00000046589
AA Change: N63S

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 330 3.8e-143 PFAM
low complexity region 504 516 N/A INTRINSIC
LRR 603 627 3.97e0 SMART
LRR 628 650 2.33e2 SMART
LRR_TYP 651 674 6.08e-5 SMART
LRR 676 696 6.78e1 SMART
LRR_TYP 697 720 2.43e-4 SMART
LRR 721 742 1.09e2 SMART
LRR_TYP 743 766 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062686
SMART Domains Protein: ENSMUSP00000054512
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110998
SMART Domains Protein: ENSMUSP00000106626
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110999
SMART Domains Protein: ENSMUSP00000106627
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
low complexity region 419 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145165
SMART Domains Protein: ENSMUSP00000117418
Gene: ENSMUSG00000109061

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207770
AA Change: N63S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small, conserved family of proteins with similar structure, including a string of extracellular leucine-rich repeats. A related protein was shown to be involved in B-cell development. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T A 17: 48,347,580 (GRCm39) K241N possibly damaging Het
Adam5 A T 8: 25,296,510 (GRCm39) S312R probably damaging Het
Atg9a C T 1: 75,163,086 (GRCm39) C338Y possibly damaging Het
Cage1 T C 13: 38,196,447 (GRCm39) E749G possibly damaging Het
Catspere2 C A 1: 177,931,275 (GRCm39) T398K unknown Het
Ccdc88b T C 19: 6,833,213 (GRCm39) E278G probably damaging Het
Ccndbp1 T C 2: 120,839,013 (GRCm39) V8A probably benign Het
Cenpt T C 8: 106,575,418 (GRCm39) D228G probably benign Het
Cfap57 A G 4: 118,463,731 (GRCm39) probably null Het
Cyp4a32 T A 4: 115,468,422 (GRCm39) N301K probably benign Het
Epha6 T C 16: 60,025,850 (GRCm39) T531A probably benign Het
Gmeb1 A T 4: 131,962,156 (GRCm39) C168S probably damaging Het
H2-DMa G A 17: 34,357,132 (GRCm39) R210H possibly damaging Het
Ighv1-7 T G 12: 114,502,198 (GRCm39) T90P probably damaging Het
Kalrn A C 16: 33,916,249 (GRCm39) M1R probably null Het
Kcnrg CACAACAA CACAA 14: 61,845,009 (GRCm39) probably benign Het
Krtap14 T C 16: 88,622,865 (GRCm39) D38G possibly damaging Het
Map4k2 T A 19: 6,392,814 (GRCm39) L152Q probably damaging Het
Mcf2l A G 8: 13,023,048 (GRCm39) D78G possibly damaging Het
Ms4a6c T C 19: 11,449,851 (GRCm39) V81A probably benign Het
Mtnr1b T C 9: 15,785,660 (GRCm39) T33A probably benign Het
Muc16 T A 9: 18,566,624 (GRCm39) Q1965L unknown Het
Nfatc2 A C 2: 168,328,898 (GRCm39) probably benign Het
Nlrp9b C T 7: 19,779,707 (GRCm39) T790I possibly damaging Het
Nol4 A T 18: 22,902,899 (GRCm39) C371S probably damaging Het
Ntn1 A C 11: 68,148,485 (GRCm39) probably benign Het
Or14j3 A G 17: 37,900,633 (GRCm39) S204P possibly damaging Het
Orc1 T C 4: 108,469,357 (GRCm39) V727A probably benign Het
Phf20l1 C T 15: 66,484,888 (GRCm39) Q318* probably null Het
Psg18 A T 7: 18,083,185 (GRCm39) Y323* probably null Het
Ptk2b T C 14: 66,409,189 (GRCm39) Y529C probably damaging Het
Rrm1 A G 7: 102,108,598 (GRCm39) Y374C probably damaging Het
Selp T A 1: 163,964,765 (GRCm39) F476I probably damaging Het
Sema3b A G 9: 107,478,957 (GRCm39) probably null Het
Setdb2 T G 14: 59,639,849 (GRCm39) T665P probably damaging Het
Sorbs3 T C 14: 70,424,387 (GRCm39) Y515C probably damaging Het
St13 G A 15: 81,272,575 (GRCm39) P90S possibly damaging Het
Stag1 T A 9: 100,836,306 (GRCm39) I1197N probably damaging Het
Svs3a A G 2: 164,132,179 (GRCm39) Y250C probably damaging Het
Ticam1 T C 17: 56,577,428 (GRCm39) I556V probably benign Het
Vmn1r180 A G 7: 23,651,620 (GRCm39) probably benign Het
Xirp2 T A 2: 67,342,235 (GRCm39) L1492* probably null Het
Zfp438 A G 18: 5,214,379 (GRCm39) V193A probably benign Het
Zfp729b A G 13: 67,739,337 (GRCm39) V976A probably benign Het
Other mutations in Lrrc8e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lrrc8e APN 8 4,285,921 (GRCm39) missense probably benign
IGL00943:Lrrc8e APN 8 4,285,658 (GRCm39) missense probably damaging 1.00
IGL00979:Lrrc8e APN 8 4,285,080 (GRCm39) missense probably damaging 1.00
IGL01138:Lrrc8e APN 8 4,284,084 (GRCm39) missense probably damaging 1.00
IGL01458:Lrrc8e APN 8 4,286,141 (GRCm39) missense probably damaging 1.00
IGL02524:Lrrc8e APN 8 4,285,392 (GRCm39) missense probably damaging 1.00
IGL02831:Lrrc8e APN 8 4,285,429 (GRCm39) missense probably damaging 0.96
IGL03135:Lrrc8e APN 8 4,285,776 (GRCm39) missense probably damaging 1.00
R0242:Lrrc8e UTSW 8 4,285,401 (GRCm39) missense probably benign 0.00
R0242:Lrrc8e UTSW 8 4,285,401 (GRCm39) missense probably benign 0.00
R0312:Lrrc8e UTSW 8 4,285,733 (GRCm39) missense probably benign
R0601:Lrrc8e UTSW 8 4,285,239 (GRCm39) splice site probably null
R1167:Lrrc8e UTSW 8 4,285,337 (GRCm39) missense probably benign
R1405:Lrrc8e UTSW 8 4,281,754 (GRCm39) missense probably damaging 1.00
R1405:Lrrc8e UTSW 8 4,281,754 (GRCm39) missense probably damaging 1.00
R1540:Lrrc8e UTSW 8 4,284,990 (GRCm39) missense probably benign 0.41
R1677:Lrrc8e UTSW 8 4,284,190 (GRCm39) missense probably damaging 1.00
R1916:Lrrc8e UTSW 8 4,285,202 (GRCm39) missense probably benign 0.01
R2185:Lrrc8e UTSW 8 4,284,986 (GRCm39) nonsense probably null
R2290:Lrrc8e UTSW 8 4,281,770 (GRCm39) missense probably damaging 1.00
R3424:Lrrc8e UTSW 8 4,284,611 (GRCm39) missense probably damaging 1.00
R4628:Lrrc8e UTSW 8 4,283,981 (GRCm39) missense probably damaging 1.00
R4996:Lrrc8e UTSW 8 4,285,166 (GRCm39) missense probably damaging 1.00
R5169:Lrrc8e UTSW 8 4,284,329 (GRCm39) missense probably benign
R5516:Lrrc8e UTSW 8 4,285,818 (GRCm39) missense probably damaging 1.00
R5870:Lrrc8e UTSW 8 4,285,725 (GRCm39) missense possibly damaging 0.60
R6687:Lrrc8e UTSW 8 4,284,798 (GRCm39) missense probably damaging 1.00
R6700:Lrrc8e UTSW 8 4,286,034 (GRCm39) missense probably damaging 1.00
R7344:Lrrc8e UTSW 8 4,284,815 (GRCm39) missense probably damaging 1.00
R7350:Lrrc8e UTSW 8 4,285,626 (GRCm39) missense probably benign 0.14
R7555:Lrrc8e UTSW 8 4,284,363 (GRCm39) missense probably benign 0.05
R7691:Lrrc8e UTSW 8 4,284,534 (GRCm39) missense probably damaging 1.00
R8112:Lrrc8e UTSW 8 4,285,575 (GRCm39) missense probably benign 0.14
R8184:Lrrc8e UTSW 8 4,285,140 (GRCm39) missense probably damaging 0.99
R8328:Lrrc8e UTSW 8 4,285,641 (GRCm39) missense probably damaging 1.00
R8355:Lrrc8e UTSW 8 4,284,018 (GRCm39) missense probably benign 0.02
R8487:Lrrc8e UTSW 8 4,284,218 (GRCm39) missense probably damaging 1.00
R8810:Lrrc8e UTSW 8 4,285,070 (GRCm39) missense probably benign 0.03
R8971:Lrrc8e UTSW 8 4,284,141 (GRCm39) missense probably damaging 1.00
R9088:Lrrc8e UTSW 8 4,284,410 (GRCm39) missense probably damaging 0.96
R9150:Lrrc8e UTSW 8 4,286,030 (GRCm39) missense probably benign 0.06
R9225:Lrrc8e UTSW 8 4,284,561 (GRCm39) missense probably damaging 1.00
R9255:Lrrc8e UTSW 8 4,284,504 (GRCm39) missense probably damaging 1.00
R9463:Lrrc8e UTSW 8 4,285,185 (GRCm39) missense probably damaging 0.99
R9475:Lrrc8e UTSW 8 4,285,346 (GRCm39) missense probably benign
Z1176:Lrrc8e UTSW 8 4,284,822 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGCTCAGCTCCCCTAGAAC -3'
(R):5'- AAGTAGGGGAAGTATTTGGCATACC -3'

Sequencing Primer
(F):5'- GATGCTATAGTTTAACAGCTCTTCC -3'
(R):5'- ATACCAGTGGAGGGCAGTCTC -3'
Posted On 2022-06-15