Incidental Mutation 'R9442:Cage1'
ID 713694
Institutional Source Beutler Lab
Gene Symbol Cage1
Ensembl Gene ENSMUSG00000044566
Gene Name cancer antigen 1
Synonyms Ctag3, CAGE1, 4933427I01Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R9442 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 38190028-38221045 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38196447 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 749 (E749G)
Ref Sequence ENSEMBL: ENSMUSP00000074499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074969] [ENSMUST00000110233]
AlphaFold Q5IR70
Predicted Effect possibly damaging
Transcript: ENSMUST00000074969
AA Change: E749G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074499
Gene: ENSMUSG00000044566
AA Change: E749G

DomainStartEndE-ValueType
Pfam:CAGE1 1 526 5.1e-292 PFAM
low complexity region 664 682 N/A INTRINSIC
coiled coil region 778 811 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110233
AA Change: E749G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105862
Gene: ENSMUSG00000044566
AA Change: E749G

DomainStartEndE-ValueType
Pfam:CAGE1 1 526 2.4e-255 PFAM
low complexity region 664 682 N/A INTRINSIC
coiled coil region 778 811 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T A 17: 48,347,580 (GRCm39) K241N possibly damaging Het
Adam5 A T 8: 25,296,510 (GRCm39) S312R probably damaging Het
Atg9a C T 1: 75,163,086 (GRCm39) C338Y possibly damaging Het
Catspere2 C A 1: 177,931,275 (GRCm39) T398K unknown Het
Ccdc88b T C 19: 6,833,213 (GRCm39) E278G probably damaging Het
Ccndbp1 T C 2: 120,839,013 (GRCm39) V8A probably benign Het
Cenpt T C 8: 106,575,418 (GRCm39) D228G probably benign Het
Cfap57 A G 4: 118,463,731 (GRCm39) probably null Het
Cyp4a32 T A 4: 115,468,422 (GRCm39) N301K probably benign Het
Epha6 T C 16: 60,025,850 (GRCm39) T531A probably benign Het
Gmeb1 A T 4: 131,962,156 (GRCm39) C168S probably damaging Het
H2-DMa G A 17: 34,357,132 (GRCm39) R210H possibly damaging Het
Ighv1-7 T G 12: 114,502,198 (GRCm39) T90P probably damaging Het
Kalrn A C 16: 33,916,249 (GRCm39) M1R probably null Het
Kcnrg CACAACAA CACAA 14: 61,845,009 (GRCm39) probably benign Het
Krtap14 T C 16: 88,622,865 (GRCm39) D38G possibly damaging Het
Lrrc8e A G 8: 4,283,964 (GRCm39) N63S probably benign Het
Map4k2 T A 19: 6,392,814 (GRCm39) L152Q probably damaging Het
Mcf2l A G 8: 13,023,048 (GRCm39) D78G possibly damaging Het
Ms4a6c T C 19: 11,449,851 (GRCm39) V81A probably benign Het
Mtnr1b T C 9: 15,785,660 (GRCm39) T33A probably benign Het
Muc16 T A 9: 18,566,624 (GRCm39) Q1965L unknown Het
Nfatc2 A C 2: 168,328,898 (GRCm39) probably benign Het
Nlrp9b C T 7: 19,779,707 (GRCm39) T790I possibly damaging Het
Nol4 A T 18: 22,902,899 (GRCm39) C371S probably damaging Het
Ntn1 A C 11: 68,148,485 (GRCm39) probably benign Het
Or14j3 A G 17: 37,900,633 (GRCm39) S204P possibly damaging Het
Orc1 T C 4: 108,469,357 (GRCm39) V727A probably benign Het
Phf20l1 C T 15: 66,484,888 (GRCm39) Q318* probably null Het
Psg18 A T 7: 18,083,185 (GRCm39) Y323* probably null Het
Ptk2b T C 14: 66,409,189 (GRCm39) Y529C probably damaging Het
Rrm1 A G 7: 102,108,598 (GRCm39) Y374C probably damaging Het
Selp T A 1: 163,964,765 (GRCm39) F476I probably damaging Het
Sema3b A G 9: 107,478,957 (GRCm39) probably null Het
Setdb2 T G 14: 59,639,849 (GRCm39) T665P probably damaging Het
Sorbs3 T C 14: 70,424,387 (GRCm39) Y515C probably damaging Het
St13 G A 15: 81,272,575 (GRCm39) P90S possibly damaging Het
Stag1 T A 9: 100,836,306 (GRCm39) I1197N probably damaging Het
Svs3a A G 2: 164,132,179 (GRCm39) Y250C probably damaging Het
Ticam1 T C 17: 56,577,428 (GRCm39) I556V probably benign Het
Vmn1r180 A G 7: 23,651,620 (GRCm39) probably benign Het
Xirp2 T A 2: 67,342,235 (GRCm39) L1492* probably null Het
Zfp438 A G 18: 5,214,379 (GRCm39) V193A probably benign Het
Zfp729b A G 13: 67,739,337 (GRCm39) V976A probably benign Het
Other mutations in Cage1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Cage1 APN 13 38,206,969 (GRCm39) nonsense probably null
IGL01736:Cage1 APN 13 38,206,789 (GRCm39) missense possibly damaging 0.93
IGL02149:Cage1 APN 13 38,206,505 (GRCm39) missense probably damaging 1.00
IGL02267:Cage1 APN 13 38,207,233 (GRCm39) missense probably damaging 1.00
IGL03030:Cage1 APN 13 38,212,123 (GRCm39) missense probably benign
IGL03216:Cage1 APN 13 38,190,153 (GRCm39) splice site probably benign
R0487:Cage1 UTSW 13 38,209,334 (GRCm39) missense probably benign 0.00
R0606:Cage1 UTSW 13 38,200,470 (GRCm39) splice site probably benign
R1015:Cage1 UTSW 13 38,200,451 (GRCm39) missense possibly damaging 0.96
R1170:Cage1 UTSW 13 38,206,856 (GRCm39) missense probably damaging 1.00
R1400:Cage1 UTSW 13 38,216,400 (GRCm39) missense possibly damaging 0.86
R1721:Cage1 UTSW 13 38,207,309 (GRCm39) nonsense probably null
R2057:Cage1 UTSW 13 38,207,356 (GRCm39) missense probably benign 0.04
R2058:Cage1 UTSW 13 38,207,356 (GRCm39) missense probably benign 0.04
R2059:Cage1 UTSW 13 38,207,356 (GRCm39) missense probably benign 0.04
R2197:Cage1 UTSW 13 38,207,029 (GRCm39) missense probably damaging 1.00
R3757:Cage1 UTSW 13 38,209,705 (GRCm39) missense possibly damaging 0.71
R3758:Cage1 UTSW 13 38,209,705 (GRCm39) missense possibly damaging 0.71
R4041:Cage1 UTSW 13 38,203,153 (GRCm39) missense possibly damaging 0.96
R4370:Cage1 UTSW 13 38,209,626 (GRCm39) missense probably damaging 1.00
R4401:Cage1 UTSW 13 38,207,078 (GRCm39) missense probably damaging 1.00
R4402:Cage1 UTSW 13 38,207,078 (GRCm39) missense probably damaging 1.00
R4403:Cage1 UTSW 13 38,207,078 (GRCm39) missense probably damaging 1.00
R4490:Cage1 UTSW 13 38,207,393 (GRCm39) missense possibly damaging 0.86
R4621:Cage1 UTSW 13 38,209,477 (GRCm39) missense possibly damaging 0.85
R4921:Cage1 UTSW 13 38,203,184 (GRCm39) missense probably benign 0.33
R4950:Cage1 UTSW 13 38,207,302 (GRCm39) missense possibly damaging 0.55
R4953:Cage1 UTSW 13 38,207,406 (GRCm39) missense possibly damaging 0.51
R5023:Cage1 UTSW 13 38,195,387 (GRCm39) nonsense probably null
R5808:Cage1 UTSW 13 38,206,301 (GRCm39) unclassified probably benign
R5845:Cage1 UTSW 13 38,199,682 (GRCm39) missense probably damaging 0.96
R6278:Cage1 UTSW 13 38,200,395 (GRCm39) missense possibly damaging 0.53
R6503:Cage1 UTSW 13 38,209,425 (GRCm39) missense possibly damaging 0.73
R6882:Cage1 UTSW 13 38,206,534 (GRCm39) missense probably damaging 1.00
R7146:Cage1 UTSW 13 38,207,025 (GRCm39) missense probably benign 0.03
R7192:Cage1 UTSW 13 38,203,220 (GRCm39) missense probably benign
R7529:Cage1 UTSW 13 38,209,731 (GRCm39) missense possibly damaging 0.71
R7580:Cage1 UTSW 13 38,206,700 (GRCm39) missense possibly damaging 0.90
R7646:Cage1 UTSW 13 38,206,823 (GRCm39) missense probably damaging 1.00
R7837:Cage1 UTSW 13 38,206,381 (GRCm39) missense not run
R8355:Cage1 UTSW 13 38,203,225 (GRCm39) missense probably damaging 0.99
R8435:Cage1 UTSW 13 38,203,161 (GRCm39) missense possibly damaging 0.73
R8466:Cage1 UTSW 13 38,206,987 (GRCm39) missense probably damaging 1.00
R9047:Cage1 UTSW 13 38,201,338 (GRCm39) missense possibly damaging 0.85
R9086:Cage1 UTSW 13 38,206,898 (GRCm39) missense probably damaging 1.00
R9146:Cage1 UTSW 13 38,207,005 (GRCm39) missense probably benign 0.16
R9587:Cage1 UTSW 13 38,207,233 (GRCm39) missense probably damaging 1.00
R9608:Cage1 UTSW 13 38,195,371 (GRCm39) missense possibly damaging 0.73
R9612:Cage1 UTSW 13 38,216,351 (GRCm39) missense probably damaging 0.99
R9630:Cage1 UTSW 13 38,206,855 (GRCm39) missense probably damaging 1.00
R9690:Cage1 UTSW 13 38,203,141 (GRCm39) critical splice donor site probably null
R9736:Cage1 UTSW 13 38,207,393 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTATGCTGAGGACCAAAAGCAG -3'
(R):5'- GCTGCTCTGTATGCAACTCAC -3'

Sequencing Primer
(F):5'- CCAAAAGCAGGGCACATGCTG -3'
(R):5'- TCTGTATGCAACTCACCCCCAG -3'
Posted On 2022-06-15