Incidental Mutation 'R9443:Lama5'
ID 713727
Institutional Source Beutler Lab
Gene Symbol Lama5
Ensembl Gene ENSMUSG00000015647
Gene Name laminin, alpha 5
Synonyms
Accession Numbers

Ncbi RefSeq: NM_001081171.2; MGI: 105382

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9443 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 180176373-180225859 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 180201729 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 475 (H475L)
Ref Sequence ENSEMBL: ENSMUSP00000015791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015791]
AlphaFold no structure available at present
PDB Structure LAMININ ALPHA5 CHAIN N-TERMINAL FRAGMENT [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000015791
AA Change: H475L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647
AA Change: H475L

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
LamNT 44 303 1.06e-132 SMART
EGF_Lam 305 361 4.35e-6 SMART
EGF_Lam 364 431 5.78e-11 SMART
EGF_Lam 434 476 1.32e-5 SMART
EGF_Lam 500 544 8.63e-10 SMART
EGF_Lam 547 590 1.16e-10 SMART
EGF_Lam 593 635 4.63e-10 SMART
EGF_Lam 638 680 6.25e-7 SMART
EGF_Lam 683 726 3.1e-11 SMART
EGF_Lam 730 779 2.99e-4 SMART
EGF_Lam 782 831 4.66e-6 SMART
EGF_Lam 834 878 3.48e-5 SMART
low complexity region 1261 1273 N/A INTRINSIC
EGF_Lam 1443 1486 7.01e-10 SMART
EGF_like 1489 1530 3.64e-1 SMART
EGF_Lam 1533 1579 8.56e-14 SMART
EGF_Lam 1582 1630 1.86e-14 SMART
LamB 1689 1819 5.86e-61 SMART
EGF_like 1818 1862 2.74e0 SMART
EGF_Lam 1865 1912 3.32e-11 SMART
EGF_Lam 1915 1968 1.61e-9 SMART
EGF_Lam 1971 2022 6.39e-13 SMART
EGF_Lam 2025 2069 1.94e-12 SMART
EGF_Lam 2072 2116 1.35e-11 SMART
EGF_like 2103 2145 3.1e1 SMART
EGF_Lam 2119 2166 1.18e-2 SMART
Pfam:Laminin_I 2189 2453 1.7e-65 PFAM
low complexity region 2532 2548 N/A INTRINSIC
low complexity region 2557 2569 N/A INTRINSIC
low complexity region 2632 2641 N/A INTRINSIC
low complexity region 2663 2676 N/A INTRINSIC
LamG 2760 2912 3.97e-8 SMART
LamG 2966 3103 1.78e-10 SMART
LamG 3149 3274 1.11e-20 SMART
LamG 3359 3497 4.05e-23 SMART
LamG 3539 3670 3e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype Strain: 3624772; 1934917
Lethality: E1-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted basal laminae leading to exencephaly, syndactyly, placentopathy, kidney defects, abnormal lobar septation with absence of a visceral pleural membrane, and lethality in late gestation. [provided by MGI curators]
Allele List at MGI

All alleles(49) : Targeted(5) Gene trapped(44)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik C T 2: 148,847,958 E92K probably damaging Het
Adad1 T C 3: 37,091,991 Y503H probably benign Het
Adck1 T C 12: 88,371,780 probably null Het
Afap1l1 T C 18: 61,746,788 D337G probably damaging Het
Afg1l G A 10: 42,313,591 T448M probably damaging Het
Aqp6 T C 15: 99,601,528 S41P Het
Atad5 T G 11: 80,132,562 V1500G probably benign Het
Btbd18 T A 2: 84,667,180 D387E probably benign Het
Catsperd A G 17: 56,662,720 N605D possibly damaging Het
Ccdc24 C T 4: 117,871,158 V102I probably benign Het
Cenpe T A 3: 135,270,848 D2405E probably damaging Het
Cfap46 T C 7: 139,615,107 D2249G Het
Chrm1 A T 19: 8,678,186 Y85F possibly damaging Het
Clstn3 C T 6: 124,451,399 G465S probably damaging Het
Col7a1 G A 9: 108,955,991 G262D unknown Het
Copg2 T C 6: 30,750,579 T736A probably benign Het
Coro2b T C 9: 62,425,798 E435G probably benign Het
Cp A T 3: 19,978,919 I637F possibly damaging Het
Cpne7 T C 8: 123,126,672 F239L probably damaging Het
Cul2 T A 18: 3,434,041 Y679* probably null Het
Dhx8 T C 11: 101,764,914 Y1158H probably damaging Het
Eda G T X: 99,976,169 R130L unknown Het
Elp6 T A 9: 110,320,936 V265D probably damaging Het
Eomes A G 9: 118,484,572 T562A Het
Fam187b A T 7: 30,977,642 E192V probably damaging Het
Foxi1 T C 11: 34,205,671 T320A probably benign Het
Gga1 C T 15: 78,881,047 T18I possibly damaging Het
Gm13128 T A 4: 144,333,108 I463N possibly damaging Het
Gm34653 C T 2: 34,838,611 Q141* probably null Het
Grik4 T A 9: 42,659,741 M223L probably benign Het
Hdac7 T C 15: 97,802,471 N594S probably benign Het
Ifnar1 C T 16: 91,495,479 P207L probably benign Het
Itpr3 T G 17: 27,105,549 F1235C probably damaging Het
Klhdc4 A G 8: 121,797,026 S484P possibly damaging Het
Kmt2c A G 5: 25,310,047 S2933P probably damaging Het
Ly6g6f A G 17: 35,080,850 L292P possibly damaging Het
Macf1 T A 4: 123,471,875 Q3031L probably benign Het
Mbd5 T G 2: 49,256,700 S307R probably damaging Het
Mertk T C 2: 128,762,109 F388L probably benign Het
Mmp11 A G 10: 75,926,899 F240S probably damaging Het
Mroh1 T A 15: 76,434,764 F949I probably damaging Het
Mroh2b T C 15: 4,944,339 L1113P probably damaging Het
Ndufv1 C A 19: 4,007,614 A454S probably benign Het
Olfr1176 T A 2: 88,340,020 W152R probably damaging Het
Olfr663 T C 7: 104,703,614 S16P probably benign Het
Olfr70 A G 4: 43,696,591 L194P probably damaging Het
Osbpl1a C A 18: 12,898,187 D329Y probably benign Het
Pcdh1 C A 18: 38,197,580 R929L probably damaging Het
Phactr2 C T 10: 13,247,097 R427K probably benign Het
Pip5k1c T C 10: 81,317,350 Y670H probably damaging Het
Plbd1 T A 6: 136,634,557 N241Y probably damaging Het
Pmvk C A 3: 89,467,649 Q139K probably benign Het
Rab3gap2 T A 1: 185,235,326 C136S probably damaging Het
Rcor3 A G 1: 192,101,750 V396A probably damaging Het
Rgs20 C A 1: 4,912,406 E147* probably null Het
Rnf167 G T 11: 70,649,951 L170F probably damaging Het
Scn9a T C 2: 66,565,209 T164A probably damaging Het
Slc52a3 A T 2: 152,004,379 I87F probably benign Het
Sntn A T 14: 13,682,364 M146L Het
Svep1 C T 4: 58,179,697 R182H possibly damaging Het
Taar7f A G 10: 24,050,413 I302V probably benign Het
Tm4sf20 T C 1: 82,768,369 I17V probably benign Het
Traf1 T C 2: 34,946,736 T270A probably benign Het
Trpm5 C T 7: 143,085,123 E304K probably benign Het
Ttc37 A G 13: 76,118,169 Q210R probably benign Het
Ttll8 T C 15: 88,925,660 D311G possibly damaging Het
Unc79 T A 12: 103,070,776 F608I probably damaging Het
Vmn2r11 A T 5: 109,047,293 C722* probably null Het
Wdr7 A G 18: 63,720,336 T36A probably damaging Het
Ybx2 C T 11: 69,940,362 P261L Het
Zfp101 C T 17: 33,382,444 V113I probably benign Het
Zfp260 T C 7: 30,104,824 S50P probably benign Het
Zfp319 A T 8: 95,328,294 F427Y probably benign Het
Zfp369 T C 13: 65,296,533 S497P possibly damaging Het
Other mutations in Lama5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Lama5 APN 2 180176543 unclassified probably benign
IGL01370:Lama5 APN 2 180197400 missense possibly damaging 0.87
IGL01474:Lama5 APN 2 180196570 missense probably damaging 1.00
IGL01614:Lama5 APN 2 180180864 missense probably damaging 1.00
IGL01941:Lama5 APN 2 180192392 missense possibly damaging 0.71
IGL01953:Lama5 APN 2 180190704 missense probably damaging 0.97
IGL02093:Lama5 APN 2 180188587 missense probably damaging 1.00
IGL02197:Lama5 APN 2 180207219 missense possibly damaging 0.82
IGL02308:Lama5 APN 2 180190327 splice site probably benign
IGL02314:Lama5 APN 2 180194482 splice site probably benign
IGL02317:Lama5 APN 2 180191319 missense probably damaging 1.00
IGL02354:Lama5 APN 2 180193884 nonsense probably null
IGL02361:Lama5 APN 2 180193884 nonsense probably null
IGL02557:Lama5 APN 2 180190932 nonsense probably null
IGL03026:Lama5 APN 2 180195967 missense probably benign 0.34
IGL03160:Lama5 APN 2 180180335 missense probably damaging 1.00
IGL03238:Lama5 APN 2 180188574 missense probably benign
IGL03390:Lama5 APN 2 180207218 missense probably damaging 1.00
blancmange UTSW 2 180180611 missense probably damaging 0.98
cupcake UTSW 2 180185959 missense probably damaging 1.00
layercake UTSW 2 180180718 missense possibly damaging 0.83
poundcake UTSW 2 180195608 missense probably damaging 1.00
Salty UTSW 2 180181651 missense possibly damaging 0.84
PIT4378001:Lama5 UTSW 2 180189445 missense possibly damaging 0.89
R0003:Lama5 UTSW 2 180178079 splice site probably null
R0056:Lama5 UTSW 2 180187106 intron probably benign
R0147:Lama5 UTSW 2 180190406 missense probably benign
R0148:Lama5 UTSW 2 180190406 missense probably benign
R0310:Lama5 UTSW 2 180181566 splice site probably benign
R0326:Lama5 UTSW 2 180182426 missense possibly damaging 0.90
R0368:Lama5 UTSW 2 180181230 nonsense probably null
R0479:Lama5 UTSW 2 180184457 missense probably benign 0.03
R0490:Lama5 UTSW 2 180180169 missense possibly damaging 0.90
R0636:Lama5 UTSW 2 180189331 critical splice donor site probably null
R0704:Lama5 UTSW 2 180179484 missense possibly damaging 0.84
R0733:Lama5 UTSW 2 180180718 missense possibly damaging 0.83
R1017:Lama5 UTSW 2 180195420 missense probably damaging 1.00
R1078:Lama5 UTSW 2 180179764 unclassified probably benign
R1294:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1423:Lama5 UTSW 2 180195641 missense probably damaging 1.00
R1438:Lama5 UTSW 2 180182800 missense probably benign 0.01
R1447:Lama5 UTSW 2 180185878 missense probably damaging 0.99
R1540:Lama5 UTSW 2 180180151 missense probably benign
R1601:Lama5 UTSW 2 180197745 missense probably damaging 1.00
R1624:Lama5 UTSW 2 180206758 missense probably benign 0.02
R1674:Lama5 UTSW 2 180201987 missense probably benign 0.00
R1687:Lama5 UTSW 2 180194066 missense probably benign 0.00
R1696:Lama5 UTSW 2 180202486 missense probably damaging 1.00
R1701:Lama5 UTSW 2 180221369 missense probably damaging 1.00
R1778:Lama5 UTSW 2 180195481 splice site probably benign
R1936:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1939:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1940:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1953:Lama5 UTSW 2 180190747 missense possibly damaging 0.94
R1966:Lama5 UTSW 2 180188352 missense probably damaging 1.00
R2024:Lama5 UTSW 2 180179130 missense probably benign 0.00
R2079:Lama5 UTSW 2 180225508 missense possibly damaging 0.68
R2115:Lama5 UTSW 2 180186885 missense probably damaging 1.00
R2173:Lama5 UTSW 2 180196242 missense probably benign 0.00
R2272:Lama5 UTSW 2 180178603 missense possibly damaging 0.93
R2357:Lama5 UTSW 2 180180097 missense probably benign 0.01
R2860:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2861:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2939:Lama5 UTSW 2 180198954 missense probably damaging 1.00
R3053:Lama5 UTSW 2 180183067 missense probably damaging 0.99
R3430:Lama5 UTSW 2 180196317 missense probably benign 0.00
R3752:Lama5 UTSW 2 180187222 missense probably damaging 1.00
R3782:Lama5 UTSW 2 180194563 missense possibly damaging 0.57
R3901:Lama5 UTSW 2 180182351 splice site probably benign
R4248:Lama5 UTSW 2 180180427 missense possibly damaging 0.84
R4626:Lama5 UTSW 2 180184460 missense probably damaging 0.98
R4638:Lama5 UTSW 2 180190413 missense possibly damaging 0.89
R4669:Lama5 UTSW 2 180180637 missense probably damaging 1.00
R4673:Lama5 UTSW 2 180199266 missense probably damaging 1.00
R4677:Lama5 UTSW 2 180179366 missense possibly damaging 0.69
R4701:Lama5 UTSW 2 180191696 missense probably damaging 1.00
R4774:Lama5 UTSW 2 180185941 missense probably damaging 1.00
R4880:Lama5 UTSW 2 180177068 unclassified probably benign
R4923:Lama5 UTSW 2 180184149 missense probably benign 0.18
R4960:Lama5 UTSW 2 180208252 critical splice donor site probably null
R4983:Lama5 UTSW 2 180193449 missense probably benign 0.13
R5061:Lama5 UTSW 2 180198786 nonsense probably null
R5080:Lama5 UTSW 2 180207200 nonsense probably null
R5135:Lama5 UTSW 2 180202220 missense possibly damaging 0.89
R5206:Lama5 UTSW 2 180191304 missense probably damaging 1.00
R5296:Lama5 UTSW 2 180193801 missense probably damaging 1.00
R5319:Lama5 UTSW 2 180181118 missense probably damaging 1.00
R5355:Lama5 UTSW 2 180181651 missense possibly damaging 0.84
R5388:Lama5 UTSW 2 180190746 missense possibly damaging 0.83
R5528:Lama5 UTSW 2 180194563 missense probably benign 0.21
R5536:Lama5 UTSW 2 180189349 missense probably damaging 0.99
R5658:Lama5 UTSW 2 180208276 nonsense probably null
R5823:Lama5 UTSW 2 180192492 missense probably benign 0.04
R5885:Lama5 UTSW 2 180201831 missense probably damaging 1.00
R5889:Lama5 UTSW 2 180193674 intron probably benign
R5912:Lama5 UTSW 2 180195475 missense probably damaging 1.00
R5955:Lama5 UTSW 2 180197474 missense probably damaging 1.00
R6015:Lama5 UTSW 2 180185392 missense probably benign 0.36
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6191:Lama5 UTSW 2 180180611 missense probably damaging 0.98
R6191:Lama5 UTSW 2 180185959 missense probably damaging 1.00
R6359:Lama5 UTSW 2 180195982 missense probably benign 0.01
R6385:Lama5 UTSW 2 180196533 missense probably damaging 1.00
R6406:Lama5 UTSW 2 180197464 nonsense probably null
R6552:Lama5 UTSW 2 180181154 missense probably damaging 0.98
R6632:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6633:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6645:Lama5 UTSW 2 180179670 missense probably damaging 1.00
R6731:Lama5 UTSW 2 180188574 missense probably benign 0.09
R6744:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6798:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6799:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6801:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6851:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6869:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6881:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6882:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6884:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R7022:Lama5 UTSW 2 180180731 missense probably damaging 1.00
R7204:Lama5 UTSW 2 180202177 missense probably damaging 1.00
R7207:Lama5 UTSW 2 180207084 missense probably damaging 0.98
R7282:Lama5 UTSW 2 180201795 missense probably damaging 1.00
R7367:Lama5 UTSW 2 180192958 missense probably benign 0.01
R7410:Lama5 UTSW 2 180202390 critical splice donor site probably null
R7699:Lama5 UTSW 2 180180861 missense probably damaging 1.00
R7849:Lama5 UTSW 2 180201812 missense probably damaging 1.00
R7909:Lama5 UTSW 2 180192276 missense possibly damaging 0.95
R7948:Lama5 UTSW 2 180202201 missense probably damaging 1.00
R8153:Lama5 UTSW 2 180187931 missense probably benign 0.37
R8317:Lama5 UTSW 2 180206991 missense probably damaging 1.00
R8351:Lama5 UTSW 2 180195608 missense probably damaging 1.00
R8370:Lama5 UTSW 2 180201487 missense possibly damaging 0.80
R8398:Lama5 UTSW 2 180197034 critical splice donor site probably null
R8401:Lama5 UTSW 2 180198787 missense probably damaging 1.00
R8404:Lama5 UTSW 2 180195222 missense probably damaging 1.00
R8502:Lama5 UTSW 2 180195222 missense probably damaging 1.00
R8694:Lama5 UTSW 2 180180884 missense probably damaging 0.98
R8705:Lama5 UTSW 2 180178561 missense probably damaging 1.00
R8732:Lama5 UTSW 2 180186688 missense probably damaging 1.00
R8755:Lama5 UTSW 2 180190921 missense probably benign 0.00
R8786:Lama5 UTSW 2 180196307 missense probably damaging 1.00
R8926:Lama5 UTSW 2 180193990 missense probably benign 0.08
R8928:Lama5 UTSW 2 180202039 missense probably damaging 1.00
R8953:Lama5 UTSW 2 180193520 missense probably damaging 0.99
R8958:Lama5 UTSW 2 180193799 missense probably benign
R9002:Lama5 UTSW 2 180196518 missense probably damaging 1.00
R9081:Lama5 UTSW 2 180192137 nonsense probably null
R9165:Lama5 UTSW 2 180179493 missense probably damaging 0.99
R9233:Lama5 UTSW 2 180198709 nonsense probably null
R9311:Lama5 UTSW 2 180196482 critical splice donor site probably null
R9488:Lama5 UTSW 2 180181441 missense possibly damaging 0.95
RF020:Lama5 UTSW 2 180196178 missense probably benign
X0065:Lama5 UTSW 2 180181731 missense probably benign 0.26
Z1177:Lama5 UTSW 2 180183630 missense probably benign 0.03
Z1177:Lama5 UTSW 2 180189419 missense probably damaging 1.00
Z1177:Lama5 UTSW 2 180190714 missense possibly damaging 0.95
Z1177:Lama5 UTSW 2 180198810 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTTGTCCACCAGGTCTGTGG -3'
(R):5'- GCTGTGTTCCTAAGCCTTGG -3'

Sequencing Primer
(F):5'- ACCAGGTCTGTGGAGCAG -3'
(R):5'- TGCGAGTCTTAGGGATCCC -3'
Posted On 2022-06-15