Incidental Mutation 'R9443:Cfap46'
ID 713745
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Name cilia and flagella associated protein 46
Synonyms 9330101J02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9443 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 139600951-139683817 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 139615107 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 2249 (D2249G)
Ref Sequence ENSEMBL: ENSMUSP00000120186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990]
AlphaFold E9Q2C0
Predicted Effect
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: D2249G

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik C T 2: 148,847,958 E92K probably damaging Het
Adad1 T C 3: 37,091,991 Y503H probably benign Het
Adck1 T C 12: 88,371,780 probably null Het
Afap1l1 T C 18: 61,746,788 D337G probably damaging Het
Afg1l G A 10: 42,313,591 T448M probably damaging Het
Aqp6 T C 15: 99,601,528 S41P Het
Atad5 T G 11: 80,132,562 V1500G probably benign Het
Btbd18 T A 2: 84,667,180 D387E probably benign Het
Catsperd A G 17: 56,662,720 N605D possibly damaging Het
Ccdc24 C T 4: 117,871,158 V102I probably benign Het
Cenpe T A 3: 135,270,848 D2405E probably damaging Het
Chrm1 A T 19: 8,678,186 Y85F possibly damaging Het
Clstn3 C T 6: 124,451,399 G465S probably damaging Het
Col7a1 G A 9: 108,955,991 G262D unknown Het
Copg2 T C 6: 30,750,579 T736A probably benign Het
Coro2b T C 9: 62,425,798 E435G probably benign Het
Cp A T 3: 19,978,919 I637F possibly damaging Het
Cpne7 T C 8: 123,126,672 F239L probably damaging Het
Cul2 T A 18: 3,434,041 Y679* probably null Het
Dhx8 T C 11: 101,764,914 Y1158H probably damaging Het
Eda G T X: 99,976,169 R130L unknown Het
Elp6 T A 9: 110,320,936 V265D probably damaging Het
Eomes A G 9: 118,484,572 T562A Het
Fam187b A T 7: 30,977,642 E192V probably damaging Het
Foxi1 T C 11: 34,205,671 T320A probably benign Het
Gga1 C T 15: 78,881,047 T18I possibly damaging Het
Gm13128 T A 4: 144,333,108 I463N possibly damaging Het
Gm34653 C T 2: 34,838,611 Q141* probably null Het
Grik4 T A 9: 42,659,741 M223L probably benign Het
Hdac7 T C 15: 97,802,471 N594S probably benign Het
Ifnar1 C T 16: 91,495,479 P207L probably benign Het
Itpr3 T G 17: 27,105,549 F1235C probably damaging Het
Klhdc4 A G 8: 121,797,026 S484P possibly damaging Het
Kmt2c A G 5: 25,310,047 S2933P probably damaging Het
Lama5 T A 2: 180,201,729 H475L probably benign Het
Ly6g6f A G 17: 35,080,850 L292P possibly damaging Het
Macf1 T A 4: 123,471,875 Q3031L probably benign Het
Mbd5 T G 2: 49,256,700 S307R probably damaging Het
Mertk T C 2: 128,762,109 F388L probably benign Het
Mmp11 A G 10: 75,926,899 F240S probably damaging Het
Mroh1 T A 15: 76,434,764 F949I probably damaging Het
Mroh2b T C 15: 4,944,339 L1113P probably damaging Het
Ndufv1 C A 19: 4,007,614 A454S probably benign Het
Olfr1176 T A 2: 88,340,020 W152R probably damaging Het
Olfr663 T C 7: 104,703,614 S16P probably benign Het
Olfr70 A G 4: 43,696,591 L194P probably damaging Het
Osbpl1a C A 18: 12,898,187 D329Y probably benign Het
Pcdh1 C A 18: 38,197,580 R929L probably damaging Het
Phactr2 C T 10: 13,247,097 R427K probably benign Het
Pip5k1c T C 10: 81,317,350 Y670H probably damaging Het
Plbd1 T A 6: 136,634,557 N241Y probably damaging Het
Pmvk C A 3: 89,467,649 Q139K probably benign Het
Rab3gap2 T A 1: 185,235,326 C136S probably damaging Het
Rcor3 A G 1: 192,101,750 V396A probably damaging Het
Rgs20 C A 1: 4,912,406 E147* probably null Het
Rnf167 G T 11: 70,649,951 L170F probably damaging Het
Scn9a T C 2: 66,565,209 T164A probably damaging Het
Slc52a3 A T 2: 152,004,379 I87F probably benign Het
Sntn A T 14: 13,682,364 M146L Het
Svep1 C T 4: 58,179,697 R182H possibly damaging Het
Taar7f A G 10: 24,050,413 I302V probably benign Het
Tm4sf20 T C 1: 82,768,369 I17V probably benign Het
Traf1 T C 2: 34,946,736 T270A probably benign Het
Trpm5 C T 7: 143,085,123 E304K probably benign Het
Ttc37 A G 13: 76,118,169 Q210R probably benign Het
Ttll8 T C 15: 88,925,660 D311G possibly damaging Het
Unc79 T A 12: 103,070,776 F608I probably damaging Het
Vmn2r11 A T 5: 109,047,293 C722* probably null Het
Wdr7 A G 18: 63,720,336 T36A probably damaging Het
Ybx2 C T 11: 69,940,362 P261L Het
Zfp101 C T 17: 33,382,444 V113I probably benign Het
Zfp260 T C 7: 30,104,824 S50P probably benign Het
Zfp319 A T 8: 95,328,294 F427Y probably benign Het
Zfp369 T C 13: 65,296,533 S497P possibly damaging Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7327:Cfap46 UTSW 7 139635146 splice site probably null
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
R7618:Cfap46 UTSW 7 139603239 missense
R7623:Cfap46 UTSW 7 139618350 missense unknown
R7765:Cfap46 UTSW 7 139651564 missense
R7971:Cfap46 UTSW 7 139635127 missense unknown
R8211:Cfap46 UTSW 7 139633304 missense unknown
R8306:Cfap46 UTSW 7 139656580 missense
R8354:Cfap46 UTSW 7 139653498 missense probably benign 0.03
R8365:Cfap46 UTSW 7 139683084 nonsense probably null
R8447:Cfap46 UTSW 7 139680986 missense possibly damaging 0.90
R8715:Cfap46 UTSW 7 139605644 missense
R8805:Cfap46 UTSW 7 139632063 missense unknown
R8830:Cfap46 UTSW 7 139615649 missense unknown
R8912:Cfap46 UTSW 7 139680181 intron probably benign
R8920:Cfap46 UTSW 7 139652526 missense
R8977:Cfap46 UTSW 7 139679933 missense probably benign 0.01
R9048:Cfap46 UTSW 7 139627343 missense unknown
R9224:Cfap46 UTSW 7 139678500 nonsense probably null
R9252:Cfap46 UTSW 7 139618249 missense unknown
R9276:Cfap46 UTSW 7 139621291 missense unknown
R9301:Cfap46 UTSW 7 139642545 missense
R9391:Cfap46 UTSW 7 139618111 missense unknown
R9402:Cfap46 UTSW 7 139635949 missense unknown
R9564:Cfap46 UTSW 7 139651555 missense not run
RF023:Cfap46 UTSW 7 139638918
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Z1176:Cfap46 UTSW 7 139639548 missense
Z1177:Cfap46 UTSW 7 139601267 missense unknown
Z1177:Cfap46 UTSW 7 139630626 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGAGTTCTGGGCCCATTACC -3'
(R):5'- CTCATGTTCCCAGAGAAGAATGG -3'

Sequencing Primer
(F):5'- TTACCCGGGCCCAATCC -3'
(R):5'- TGTGCCCAGAAGACCTTCC -3'
Posted On 2022-06-15