Incidental Mutation 'R9443:Mroh2b'
ID 713770
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Name maestro heat-like repeat family member 2B
Synonyms 4930455B06Rik, Heatr7b2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock # R9443 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 4898737-4962205 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4944339 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1113 (L1113P)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
AlphaFold Q7M6Y6
Predicted Effect probably damaging
Transcript: ENSMUST00000045736
AA Change: L1113P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: L1113P

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik C T 2: 148,847,958 E92K probably damaging Het
Adad1 T C 3: 37,091,991 Y503H probably benign Het
Adck1 T C 12: 88,371,780 probably null Het
Afap1l1 T C 18: 61,746,788 D337G probably damaging Het
Afg1l G A 10: 42,313,591 T448M probably damaging Het
Aqp6 T C 15: 99,601,528 S41P Het
Atad5 T G 11: 80,132,562 V1500G probably benign Het
Btbd18 T A 2: 84,667,180 D387E probably benign Het
Catsperd A G 17: 56,662,720 N605D possibly damaging Het
Ccdc24 C T 4: 117,871,158 V102I probably benign Het
Cenpe T A 3: 135,270,848 D2405E probably damaging Het
Cfap46 T C 7: 139,615,107 D2249G Het
Chrm1 A T 19: 8,678,186 Y85F possibly damaging Het
Clstn3 C T 6: 124,451,399 G465S probably damaging Het
Col7a1 G A 9: 108,955,991 G262D unknown Het
Copg2 T C 6: 30,750,579 T736A probably benign Het
Coro2b T C 9: 62,425,798 E435G probably benign Het
Cp A T 3: 19,978,919 I637F possibly damaging Het
Cpne7 T C 8: 123,126,672 F239L probably damaging Het
Cul2 T A 18: 3,434,041 Y679* probably null Het
Dhx8 T C 11: 101,764,914 Y1158H probably damaging Het
Eda G T X: 99,976,169 R130L unknown Het
Elp6 T A 9: 110,320,936 V265D probably damaging Het
Eomes A G 9: 118,484,572 T562A Het
Fam187b A T 7: 30,977,642 E192V probably damaging Het
Foxi1 T C 11: 34,205,671 T320A probably benign Het
Gga1 C T 15: 78,881,047 T18I possibly damaging Het
Gm13128 T A 4: 144,333,108 I463N possibly damaging Het
Gm34653 C T 2: 34,838,611 Q141* probably null Het
Grik4 T A 9: 42,659,741 M223L probably benign Het
Hdac7 T C 15: 97,802,471 N594S probably benign Het
Ifnar1 C T 16: 91,495,479 P207L probably benign Het
Itpr3 T G 17: 27,105,549 F1235C probably damaging Het
Klhdc4 A G 8: 121,797,026 S484P possibly damaging Het
Kmt2c A G 5: 25,310,047 S2933P probably damaging Het
Lama5 T A 2: 180,201,729 H475L probably benign Het
Ly6g6f A G 17: 35,080,850 L292P possibly damaging Het
Macf1 T A 4: 123,471,875 Q3031L probably benign Het
Mbd5 T G 2: 49,256,700 S307R probably damaging Het
Mertk T C 2: 128,762,109 F388L probably benign Het
Mmp11 A G 10: 75,926,899 F240S probably damaging Het
Mroh1 T A 15: 76,434,764 F949I probably damaging Het
Ndufv1 C A 19: 4,007,614 A454S probably benign Het
Olfr1176 T A 2: 88,340,020 W152R probably damaging Het
Olfr663 T C 7: 104,703,614 S16P probably benign Het
Olfr70 A G 4: 43,696,591 L194P probably damaging Het
Osbpl1a C A 18: 12,898,187 D329Y probably benign Het
Pcdh1 C A 18: 38,197,580 R929L probably damaging Het
Phactr2 C T 10: 13,247,097 R427K probably benign Het
Pip5k1c T C 10: 81,317,350 Y670H probably damaging Het
Plbd1 T A 6: 136,634,557 N241Y probably damaging Het
Pmvk C A 3: 89,467,649 Q139K probably benign Het
Rab3gap2 T A 1: 185,235,326 C136S probably damaging Het
Rcor3 A G 1: 192,101,750 V396A probably damaging Het
Rgs20 C A 1: 4,912,406 E147* probably null Het
Rnf167 G T 11: 70,649,951 L170F probably damaging Het
Scn9a T C 2: 66,565,209 T164A probably damaging Het
Slc52a3 A T 2: 152,004,379 I87F probably benign Het
Sntn A T 14: 13,682,364 M146L Het
Svep1 C T 4: 58,179,697 R182H possibly damaging Het
Taar7f A G 10: 24,050,413 I302V probably benign Het
Tm4sf20 T C 1: 82,768,369 I17V probably benign Het
Traf1 T C 2: 34,946,736 T270A probably benign Het
Trpm5 C T 7: 143,085,123 E304K probably benign Het
Ttc37 A G 13: 76,118,169 Q210R probably benign Het
Ttll8 T C 15: 88,925,660 D311G possibly damaging Het
Unc79 T A 12: 103,070,776 F608I probably damaging Het
Vmn2r11 A T 5: 109,047,293 C722* probably null Het
Wdr7 A G 18: 63,720,336 T36A probably damaging Het
Ybx2 C T 11: 69,940,362 P261L Het
Zfp101 C T 17: 33,382,444 V113I probably benign Het
Zfp260 T C 7: 30,104,824 S50P probably benign Het
Zfp319 A T 8: 95,328,294 F427Y probably benign Het
Zfp369 T C 13: 65,296,533 S497P possibly damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 splice site probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
R7848:Mroh2b UTSW 15 4938379 nonsense probably null
R7952:Mroh2b UTSW 15 4951211 missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4921357 nonsense probably null
R8088:Mroh2b UTSW 15 4900503 missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4938410 missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4909040 missense probably benign 0.04
R8248:Mroh2b UTSW 15 4931104 missense probably benign 0.40
R8258:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8259:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8304:Mroh2b UTSW 15 4925637 missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4951264 nonsense probably null
R8345:Mroh2b UTSW 15 4944326 missense probably benign 0.09
R8507:Mroh2b UTSW 15 4949090 missense probably damaging 1.00
R8728:Mroh2b UTSW 15 4905640 missense probably damaging 1.00
R8747:Mroh2b UTSW 15 4935300 missense probably damaging 0.99
R8798:Mroh2b UTSW 15 4948709 missense probably damaging 1.00
R8814:Mroh2b UTSW 15 4941625 missense possibly damaging 0.61
R8856:Mroh2b UTSW 15 4931028 nonsense probably null
R8910:Mroh2b UTSW 15 4931373 missense probably benign 0.01
R8913:Mroh2b UTSW 15 4917528 intron probably benign
R8941:Mroh2b UTSW 15 4962124 missense possibly damaging 0.86
R9014:Mroh2b UTSW 15 4899188 start codon destroyed probably null 0.95
R9086:Mroh2b UTSW 15 4953272 critical splice acceptor site probably null
R9101:Mroh2b UTSW 15 4900453 missense probably benign 0.20
R9118:Mroh2b UTSW 15 4962091 missense possibly damaging 0.86
R9393:Mroh2b UTSW 15 4951184 missense probably benign
R9429:Mroh2b UTSW 15 4934425 missense probably damaging 1.00
R9431:Mroh2b UTSW 15 4934470 missense probably damaging 1.00
R9447:Mroh2b UTSW 15 4931341 missense probably damaging 1.00
R9497:Mroh2b UTSW 15 4921363 missense probably damaging 0.98
R9588:Mroh2b UTSW 15 4948648 missense not run
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4905005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTATGATACTGACATATCTGC -3'
(R):5'- CTGCTGCCACGTTTGTTCAG -3'

Sequencing Primer
(F):5'- TGATACTGACATATCTGCTTTTGC -3'
(R):5'- AATGCTCCATTGGGAGCA -3'
Posted On 2022-06-15