Incidental Mutation 'R9444:Rnf213'
ID 713827
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Name ring finger protein 213
Synonyms D11Ertd759e
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9444 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 119393100-119487418 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119434797 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1509 (Y1509C)
Ref Sequence ENSEMBL: ENSMUSP00000091429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: Y1509C

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000131035
AA Change: Y1508C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: Y1508C

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,953,226 (GRCm38) D106G probably damaging Het
Acacb T C 5: 114,245,959 (GRCm38) I2183T probably damaging Het
Adam17 A C 12: 21,325,535 (GRCm38) L761R probably benign Het
Apobr A G 7: 126,585,968 (GRCm38) D217G probably benign Het
Arhgap12 A T 18: 6,052,909 (GRCm38) Y434* probably null Het
Brwd1 T C 16: 96,053,980 (GRCm38) D416G possibly damaging Het
C1qtnf2 T C 11: 43,485,834 (GRCm38) I11T probably damaging Het
C1qtnf6 C T 15: 78,527,344 (GRCm38) C44Y probably damaging Het
Cacna1d A C 14: 30,107,784 (GRCm38) probably null Het
Card11 T A 5: 140,908,638 (GRCm38) I79F probably damaging Het
Chuk T C 19: 44,086,946 (GRCm38) D490G Het
Cilp2 T C 8: 69,882,896 (GRCm38) D484G probably damaging Het
Col8a1 C A 16: 57,628,092 (GRCm38) G352* probably null Het
Csmd1 A G 8: 16,158,236 (GRCm38) F1235S probably benign Het
Dopey2 T A 16: 93,810,239 (GRCm38) D2260E probably benign Het
Drd2 T C 9: 49,407,047 (GRCm38) F430L probably damaging Het
Fbxl17 A T 17: 63,471,460 (GRCm38) I485K probably damaging Het
Frem2 A G 3: 53,652,844 (GRCm38) V1414A probably benign Het
Galnt13 C A 2: 55,112,916 (GRCm38) S578R probably benign Het
Gfra2 T A 14: 70,966,311 (GRCm38) M300K possibly damaging Het
Gm12695 C T 4: 96,723,958 (GRCm38) A523T probably damaging Het
Gm19965 T C 1: 116,804,663 (GRCm38) S79P Het
Gm884 G A 11: 103,618,020 (GRCm38) Q1041* probably null Het
Hsf1 T C 15: 76,500,569 (GRCm38) S487P probably damaging Het
Ifnar1 C T 16: 91,495,479 (GRCm38) P207L probably benign Het
Jag1 A C 2: 137,094,477 (GRCm38) W366G probably damaging Het
Larp4 T C 15: 100,011,926 (GRCm38) S638P probably benign Het
Lipm A G 19: 34,121,290 (GRCm38) D388G probably damaging Het
Lrp1b T A 2: 41,123,718 (GRCm38) Y1925F Het
Mchr1 T C 15: 81,237,718 (GRCm38) V223A possibly damaging Het
Mfrp T A 9: 44,106,143 (GRCm38) I505N probably damaging Het
Msc T C 1: 14,755,490 (GRCm38) K87E probably damaging Het
Myo7a A G 7: 98,093,491 (GRCm38) F433L possibly damaging Het
Ncapg2 G A 12: 116,407,243 (GRCm38) R4H probably damaging Het
Ntrk3 G A 7: 78,461,057 (GRCm38) L299F probably damaging Het
Nup210 T A 6: 91,071,903 (GRCm38) Y457F probably benign Het
Olfr1298 T C 2: 111,645,787 (GRCm38) D70G probably damaging Het
Olfr141 T A 2: 86,806,142 (GRCm38) I286F Het
Olfr186 T C 16: 59,027,655 (GRCm38) D84G probably benign Het
Olfr726 T C 14: 50,084,412 (GRCm38) K90E Het
Olfr951 A G 9: 39,394,069 (GRCm38) N90D probably benign Het
Ovgp1 CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA 3: 105,986,525 (GRCm38) probably benign Het
Pcdh15 A G 10: 74,642,344 (GRCm38) Y217C probably damaging Het
Pde6h T G 6: 136,959,361 (GRCm38) F34C probably damaging Het
Pkhd1l1 A G 15: 44,554,657 (GRCm38) E2903G probably benign Het
Pnp T C 14: 50,950,595 (GRCm38) V113A probably damaging Het
Prss35 A G 9: 86,756,104 (GRCm38) D309G probably damaging Het
Pzp T C 6: 128,510,399 (GRCm38) R501G Het
Rfx8 A T 1: 39,670,316 (GRCm38) V517D probably damaging Het
Rtp4 T C 16: 23,613,086 (GRCm38) Y123H probably benign Het
Sema3e A G 5: 14,252,611 (GRCm38) I717V possibly damaging Het
Stap2 A T 17: 56,000,907 (GRCm38) V150E possibly damaging Het
Stard9 C A 2: 120,664,933 (GRCm38) N96K probably damaging Het
Stoml2 T C 4: 43,030,442 (GRCm38) T93A probably damaging Het
Suclg2 T C 6: 95,566,493 (GRCm38) D319G probably damaging Het
Tcf12 C T 9: 72,110,758 (GRCm38) D19N probably damaging Het
Tcp10c T A 17: 13,361,241 (GRCm38) probably null Het
Tll1 T C 8: 64,016,089 (GRCm38) Y1000C probably damaging Het
Trappc10 G T 10: 78,197,778 (GRCm38) T985N probably benign Het
Trpc7 T A 13: 56,776,155 (GRCm38) K794M possibly damaging Het
Unc5c G T 3: 141,801,448 (GRCm38) probably null Het
Upf2 T A 2: 6,018,944 (GRCm38) C702S unknown Het
Wdhd1 A G 14: 47,250,867 (GRCm38) F728L possibly damaging Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119,449,343 (GRCm38) missense probably benign 0.00
IGL00961:Rnf213 APN 11 119,440,843 (GRCm38) missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119,447,237 (GRCm38) missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119,483,118 (GRCm38) missense probably benign 0.25
IGL01403:Rnf213 APN 11 119,443,300 (GRCm38) missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119,449,876 (GRCm38) critical splice donor site probably null
IGL01765:Rnf213 APN 11 119,436,352 (GRCm38) missense probably benign 0.00
IGL01803:Rnf213 APN 11 119,441,307 (GRCm38) missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119,442,266 (GRCm38) missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119,443,015 (GRCm38) missense probably benign 0.05
IGL01944:Rnf213 APN 11 119,416,457 (GRCm38) missense probably benign 0.01
IGL01982:Rnf213 APN 11 119,443,268 (GRCm38) missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119,418,309 (GRCm38) splice site probably benign
IGL02084:Rnf213 APN 11 119,445,673 (GRCm38) missense probably benign 0.04
IGL02253:Rnf213 APN 11 119,440,650 (GRCm38) missense probably benign 0.03
IGL02254:Rnf213 APN 11 119,480,907 (GRCm38) missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119,463,336 (GRCm38) missense probably benign 0.01
IGL02531:Rnf213 APN 11 119,436,802 (GRCm38) missense probably benign
IGL02588:Rnf213 APN 11 119,416,536 (GRCm38) missense probably benign 0.30
IGL02615:Rnf213 APN 11 119,440,789 (GRCm38) missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119,435,066 (GRCm38) missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119,427,510 (GRCm38) missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119,479,941 (GRCm38) missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119,445,626 (GRCm38) splice site probably benign
IGL03057:Rnf213 APN 11 119,441,087 (GRCm38) missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119,465,007 (GRCm38) missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119,474,172 (GRCm38) missense probably benign 0.03
IGL03339:Rnf213 APN 11 119,443,004 (GRCm38) missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119,421,468 (GRCm38) missense probably benign 0.34
attrition UTSW 11 119,430,321 (GRCm38) missense possibly damaging 0.77
defame UTSW 11 119,430,281 (GRCm38) nonsense probably null
Derogate UTSW 11 119,470,210 (GRCm38) missense probably damaging 1.00
dinky UTSW 11 119,416,458 (GRCm38) missense probably damaging 0.99
G1funyon_rnf213_024 UTSW 11 119,434,742 (GRCm38) missense
Impugn UTSW 11 119,436,823 (GRCm38) nonsense probably null
R4332_Rnf213_642 UTSW 11 119,436,676 (GRCm38) missense probably damaging 1.00
B6584:Rnf213 UTSW 11 119,426,069 (GRCm38) missense probably damaging 0.97
G1Funyon:Rnf213 UTSW 11 119,434,742 (GRCm38) missense
PIT4585001:Rnf213 UTSW 11 119,458,392 (GRCm38) missense
R0008:Rnf213 UTSW 11 119,465,052 (GRCm38) missense possibly damaging 0.82
R0015:Rnf213 UTSW 11 119,441,606 (GRCm38) missense possibly damaging 0.95
R0041:Rnf213 UTSW 11 119,402,575 (GRCm38) missense probably benign 0.41
R0114:Rnf213 UTSW 11 119,414,587 (GRCm38) missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119,430,361 (GRCm38) missense probably benign 0.10
R0131:Rnf213 UTSW 11 119,430,361 (GRCm38) missense probably benign 0.10
R0132:Rnf213 UTSW 11 119,430,361 (GRCm38) missense probably benign 0.10
R0138:Rnf213 UTSW 11 119,416,496 (GRCm38) missense probably benign 0.05
R0144:Rnf213 UTSW 11 119,479,600 (GRCm38) nonsense probably null
R0184:Rnf213 UTSW 11 119,414,521 (GRCm38) missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119,438,105 (GRCm38) nonsense probably null
R0365:Rnf213 UTSW 11 119,426,111 (GRCm38) missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119,414,469 (GRCm38) missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119,447,257 (GRCm38) missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119,426,012 (GRCm38) missense possibly damaging 0.65
R0494:Rnf213 UTSW 11 119,443,120 (GRCm38) missense probably damaging 1.00
R0549:Rnf213 UTSW 11 119,465,082 (GRCm38) missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119,443,280 (GRCm38) missense probably damaging 1.00
R0605:Rnf213 UTSW 11 119,431,717 (GRCm38) missense probably benign 0.03
R0638:Rnf213 UTSW 11 119,470,210 (GRCm38) missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119,441,834 (GRCm38) missense probably benign 0.28
R0715:Rnf213 UTSW 11 119,441,150 (GRCm38) missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119,441,068 (GRCm38) missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119,473,480 (GRCm38) missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119,423,095 (GRCm38) critical splice donor site probably null
R0890:Rnf213 UTSW 11 119,430,486 (GRCm38) missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119,414,570 (GRCm38) missense probably benign 0.00
R0940:Rnf213 UTSW 11 119,416,563 (GRCm38) missense probably benign 0.10
R0959:Rnf213 UTSW 11 119,452,581 (GRCm38) missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119,485,998 (GRCm38) splice site probably benign
R1104:Rnf213 UTSW 11 119,477,229 (GRCm38) missense probably benign 0.29
R1141:Rnf213 UTSW 11 119,435,983 (GRCm38) missense probably benign 0.02
R1219:Rnf213 UTSW 11 119,436,177 (GRCm38) missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119,436,005 (GRCm38) missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119,442,400 (GRCm38) missense probably damaging 1.00
R1474:Rnf213 UTSW 11 119,437,750 (GRCm38) missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119,480,889 (GRCm38) missense probably benign 0.05
R1523:Rnf213 UTSW 11 119,441,888 (GRCm38) missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119,442,707 (GRCm38) missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119,441,839 (GRCm38) missense probably benign 0.06
R1563:Rnf213 UTSW 11 119,414,526 (GRCm38) missense probably benign 0.13
R1572:Rnf213 UTSW 11 119,436,611 (GRCm38) missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119,463,345 (GRCm38) missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119,442,579 (GRCm38) missense probably damaging 0.97
R1663:Rnf213 UTSW 11 119,437,672 (GRCm38) missense probably benign 0.01
R1789:Rnf213 UTSW 11 119,440,221 (GRCm38) missense probably damaging 0.97
R1844:Rnf213 UTSW 11 119,441,183 (GRCm38) missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119,450,129 (GRCm38) missense probably benign 0.08
R1893:Rnf213 UTSW 11 119,416,448 (GRCm38) missense probably damaging 1.00
R1937:Rnf213 UTSW 11 119,431,685 (GRCm38) missense probably damaging 1.00
R1967:Rnf213 UTSW 11 119,480,895 (GRCm38) missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119,441,107 (GRCm38) missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119,436,022 (GRCm38) missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119,461,918 (GRCm38) missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119,467,302 (GRCm38) nonsense probably null
R2109:Rnf213 UTSW 11 119,442,663 (GRCm38) nonsense probably null
R2115:Rnf213 UTSW 11 119,428,013 (GRCm38) missense probably benign 0.00
R2126:Rnf213 UTSW 11 119,450,201 (GRCm38) missense probably damaging 0.99
R2144:Rnf213 UTSW 11 119,443,690 (GRCm38) missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119,415,193 (GRCm38) missense probably benign 0.03
R2168:Rnf213 UTSW 11 119,415,070 (GRCm38) missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119,430,361 (GRCm38) missense probably benign 0.10
R2199:Rnf213 UTSW 11 119,460,009 (GRCm38) missense probably benign 0.01
R2220:Rnf213 UTSW 11 119,436,428 (GRCm38) missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119,414,604 (GRCm38) missense probably benign 0.02
R2400:Rnf213 UTSW 11 119,443,195 (GRCm38) missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119,459,938 (GRCm38) splice site probably null
R2698:Rnf213 UTSW 11 119,410,144 (GRCm38) missense probably benign 0.26
R3151:Rnf213 UTSW 11 119,468,892 (GRCm38) missense probably benign 0.03
R3607:Rnf213 UTSW 11 119,441,976 (GRCm38) nonsense probably null
R3808:Rnf213 UTSW 11 119,479,558 (GRCm38) missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119,480,939 (GRCm38) splice site probably benign
R3856:Rnf213 UTSW 11 119,480,939 (GRCm38) splice site probably benign
R3973:Rnf213 UTSW 11 119,469,053 (GRCm38) missense
R4014:Rnf213 UTSW 11 119,445,729 (GRCm38) nonsense probably null
R4049:Rnf213 UTSW 11 119,482,448 (GRCm38) missense possibly damaging 0.67
R4130:Rnf213 UTSW 11 119,483,006 (GRCm38) missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119,409,482 (GRCm38) missense probably benign 0.27
R4167:Rnf213 UTSW 11 119,441,243 (GRCm38) missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119,436,823 (GRCm38) nonsense probably null
R4332:Rnf213 UTSW 11 119,436,676 (GRCm38) missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119,483,964 (GRCm38) missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119,479,670 (GRCm38) critical splice donor site probably null
R4609:Rnf213 UTSW 11 119,437,695 (GRCm38) missense possibly damaging 0.86
R4684:Rnf213 UTSW 11 119,441,125 (GRCm38) missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119,440,349 (GRCm38) missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119,420,067 (GRCm38) missense probably benign 0.38
R4751:Rnf213 UTSW 11 119,445,745 (GRCm38) missense probably benign 0.12
R4828:Rnf213 UTSW 11 119,416,629 (GRCm38) missense possibly damaging 0.61
R4837:Rnf213 UTSW 11 119,442,763 (GRCm38) missense probably benign 0.00
R4894:Rnf213 UTSW 11 119,481,240 (GRCm38) missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119,428,157 (GRCm38) missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119,436,764 (GRCm38) missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119,410,807 (GRCm38) missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119,458,866 (GRCm38) missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119,440,816 (GRCm38) missense probably benign 0.00
R5406:Rnf213 UTSW 11 119,440,808 (GRCm38) missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119,409,020 (GRCm38) missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119,415,076 (GRCm38) missense probably benign 0.44
R5520:Rnf213 UTSW 11 119,433,499 (GRCm38) missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119,436,905 (GRCm38) missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119,436,629 (GRCm38) missense probably benign 0.04
R5669:Rnf213 UTSW 11 119,458,785 (GRCm38) missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119,434,686 (GRCm38) critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119,483,894 (GRCm38) missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119,416,458 (GRCm38) missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119,436,295 (GRCm38) missense probably benign
R5861:Rnf213 UTSW 11 119,473,377 (GRCm38) missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119,421,369 (GRCm38) missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119,443,079 (GRCm38) missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119,486,010 (GRCm38) missense probably benign 0.00
R6043:Rnf213 UTSW 11 119,442,101 (GRCm38) missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119,416,559 (GRCm38) missense probably benign 0.14
R6123:Rnf213 UTSW 11 119,411,513 (GRCm38) missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119,411,470 (GRCm38) missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119,442,028 (GRCm38) missense probably benign 0.02
R6146:Rnf213 UTSW 11 119,435,999 (GRCm38) missense probably benign 0.41
R6163:Rnf213 UTSW 11 119,458,428 (GRCm38) missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119,414,548 (GRCm38) missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119,463,366 (GRCm38) missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119,477,078 (GRCm38) missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119,459,966 (GRCm38) missense probably benign 0.03
R6468:Rnf213 UTSW 11 119,452,687 (GRCm38) missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119,436,280 (GRCm38) missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119,479,920 (GRCm38) missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119,430,321 (GRCm38) missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119,442,271 (GRCm38) missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119,442,236 (GRCm38) missense probably damaging 0.99
R6817:Rnf213 UTSW 11 119,462,285 (GRCm38) critical splice donor site probably null
R6820:Rnf213 UTSW 11 119,448,838 (GRCm38) missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119,449,866 (GRCm38) missense probably benign 0.26
R6934:Rnf213 UTSW 11 119,420,067 (GRCm38) missense probably benign 0.38
R7026:Rnf213 UTSW 11 119,479,655 (GRCm38) missense possibly damaging 0.58
R7094:Rnf213 UTSW 11 119,437,604 (GRCm38) splice site probably null
R7170:Rnf213 UTSW 11 119,452,575 (GRCm38) missense
R7185:Rnf213 UTSW 11 119,424,198 (GRCm38) missense
R7239:Rnf213 UTSW 11 119,458,788 (GRCm38) missense
R7258:Rnf213 UTSW 11 119,452,575 (GRCm38) missense
R7259:Rnf213 UTSW 11 119,452,575 (GRCm38) missense
R7260:Rnf213 UTSW 11 119,452,575 (GRCm38) missense
R7273:Rnf213 UTSW 11 119,431,756 (GRCm38) splice site probably null
R7282:Rnf213 UTSW 11 119,437,992 (GRCm38) missense
R7311:Rnf213 UTSW 11 119,416,547 (GRCm38) missense
R7352:Rnf213 UTSW 11 119,443,579 (GRCm38) missense
R7369:Rnf213 UTSW 11 119,430,468 (GRCm38) missense
R7410:Rnf213 UTSW 11 119,435,051 (GRCm38) missense
R7448:Rnf213 UTSW 11 119,481,291 (GRCm38) missense
R7561:Rnf213 UTSW 11 119,441,719 (GRCm38) missense
R7573:Rnf213 UTSW 11 119,458,484 (GRCm38) missense
R7615:Rnf213 UTSW 11 119,467,297 (GRCm38) missense
R7680:Rnf213 UTSW 11 119,479,556 (GRCm38) missense
R7739:Rnf213 UTSW 11 119,410,861 (GRCm38) missense
R7789:Rnf213 UTSW 11 119,470,219 (GRCm38) splice site probably null
R7806:Rnf213 UTSW 11 119,411,545 (GRCm38) missense
R8031:Rnf213 UTSW 11 119,430,281 (GRCm38) nonsense probably null
R8042:Rnf213 UTSW 11 119,441,654 (GRCm38) missense
R8053:Rnf213 UTSW 11 119,402,647 (GRCm38) missense
R8284:Rnf213 UTSW 11 119,428,083 (GRCm38) missense
R8301:Rnf213 UTSW 11 119,434,742 (GRCm38) missense
R8325:Rnf213 UTSW 11 119,430,445 (GRCm38) missense
R8332:Rnf213 UTSW 11 119,483,698 (GRCm38) missense
R8443:Rnf213 UTSW 11 119,449,323 (GRCm38) missense
R8518:Rnf213 UTSW 11 119,462,217 (GRCm38) missense
R8531:Rnf213 UTSW 11 119,474,205 (GRCm38) missense probably benign 0.02
R8670:Rnf213 UTSW 11 119,458,737 (GRCm38) missense
R8675:Rnf213 UTSW 11 119,456,158 (GRCm38) missense
R8690:Rnf213 UTSW 11 119,441,212 (GRCm38) missense
R8690:Rnf213 UTSW 11 119,418,129 (GRCm38) missense
R8714:Rnf213 UTSW 11 119,468,894 (GRCm38) missense
R8802:Rnf213 UTSW 11 119,462,102 (GRCm38) missense
R8861:Rnf213 UTSW 11 119,442,236 (GRCm38) missense
R8886:Rnf213 UTSW 11 119,473,438 (GRCm38) missense
R8893:Rnf213 UTSW 11 119,443,042 (GRCm38) missense
R8937:Rnf213 UTSW 11 119,430,274 (GRCm38) missense possibly damaging 0.94
R8941:Rnf213 UTSW 11 119,414,424 (GRCm38) missense probably damaging 1.00
R8973:Rnf213 UTSW 11 119,461,930 (GRCm38) missense
R8983:Rnf213 UTSW 11 119,430,349 (GRCm38) missense
R9043:Rnf213 UTSW 11 119,458,913 (GRCm38) missense
R9081:Rnf213 UTSW 11 119,466,236 (GRCm38) missense
R9132:Rnf213 UTSW 11 119,483,916 (GRCm38) missense
R9135:Rnf213 UTSW 11 119,408,747 (GRCm38) missense
R9146:Rnf213 UTSW 11 119,443,673 (GRCm38) missense
R9156:Rnf213 UTSW 11 119,440,748 (GRCm38) missense
R9183:Rnf213 UTSW 11 119,427,622 (GRCm38) missense
R9234:Rnf213 UTSW 11 119,450,117 (GRCm38) missense
R9275:Rnf213 UTSW 11 119,435,942 (GRCm38) missense
R9278:Rnf213 UTSW 11 119,435,942 (GRCm38) missense
R9296:Rnf213 UTSW 11 119,443,795 (GRCm38) splice site probably benign
R9350:Rnf213 UTSW 11 119,442,149 (GRCm38) missense
R9366:Rnf213 UTSW 11 119,436,231 (GRCm38) missense
R9413:Rnf213 UTSW 11 119,466,233 (GRCm38) missense
R9464:Rnf213 UTSW 11 119,463,580 (GRCm38) missense
R9605:Rnf213 UTSW 11 119,469,053 (GRCm38) missense
R9649:Rnf213 UTSW 11 119,479,631 (GRCm38) missense
R9651:Rnf213 UTSW 11 119,440,412 (GRCm38) missense
R9664:Rnf213 UTSW 11 119,441,968 (GRCm38) missense
R9696:Rnf213 UTSW 11 119,468,980 (GRCm38) missense
R9710:Rnf213 UTSW 11 119,441,005 (GRCm38) missense
R9797:Rnf213 UTSW 11 119,442,539 (GRCm38) missense
S24628:Rnf213 UTSW 11 119,414,469 (GRCm38) missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119,441,824 (GRCm38) missense probably benign 0.14
X0062:Rnf213 UTSW 11 119,473,513 (GRCm38) missense probably benign 0.05
X0064:Rnf213 UTSW 11 119,440,463 (GRCm38) missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119,477,254 (GRCm38) missense possibly damaging 0.69
Z1176:Rnf213 UTSW 11 119,482,998 (GRCm38) missense
Z1176:Rnf213 UTSW 11 119,441,410 (GRCm38) missense
Predicted Primers PCR Primer
(F):5'- AGTGCCAGTGAGGACATGTC -3'
(R):5'- CTTTCCAGACATGAGCATCAGC -3'

Sequencing Primer
(F):5'- GTGAGGACATGTCTACTCACTCCAG -3'
(R):5'- AGTAGGTGCGCAATGCCTC -3'
Posted On 2022-06-15