Incidental Mutation 'R9445:Abca14'
ID 713880
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene Name ATP-binding cassette, sub-family A member 14
Synonyms 1700110B15Rik, 4930539G24Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9445 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 119803184-119924575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119877691 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1069 (S1069P)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
AlphaFold E9Q8F8
Predicted Effect probably benign
Transcript: ENSMUST00000084640
AA Change: S1069P

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: S1069P

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (72/73)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T A 14: 41,818,174 (GRCm39) H23Q possibly damaging Het
Abo A G 2: 26,733,720 (GRCm39) W160R probably damaging Het
Adgrb1 A T 15: 74,435,807 (GRCm39) probably benign Het
Ahnak2 T C 12: 112,745,978 (GRCm39) Q1624R Het
Amy2a1 T A 3: 113,325,324 (GRCm39) N90I possibly damaging Het
Bod1l C T 5: 41,974,619 (GRCm39) V2232I probably benign Het
Brsk2 T A 7: 141,538,149 (GRCm39) H98Q probably damaging Het
Caskin2 C T 11: 115,694,576 (GRCm39) V342I probably damaging Het
Ccdc13 T C 9: 121,627,156 (GRCm39) N707S probably benign Het
Cdv3 T C 9: 103,241,240 (GRCm39) E109G probably damaging Het
Coro2a C T 4: 46,540,558 (GRCm39) E454K probably benign Het
Cpq A T 15: 33,213,391 (GRCm39) I137F possibly damaging Het
Ctsj G A 13: 61,151,838 (GRCm39) T73I possibly damaging Het
Dchs2 A G 3: 83,146,284 (GRCm39) D710G probably damaging Het
Drd4 T C 7: 140,872,162 (GRCm39) V71A probably damaging Het
Eef2k T C 7: 120,457,694 (GRCm39) C18R probably benign Het
Ercc4 C A 16: 12,945,474 (GRCm39) D386E probably benign Het
F2rl2 A C 13: 95,837,622 (GRCm39) L222F probably benign Het
Fkbp4 T C 6: 128,413,580 (GRCm39) D68G probably damaging Het
Fsip2 A T 2: 82,806,132 (GRCm39) D817V probably damaging Het
Gm19410 G A 8: 36,239,652 (GRCm39) R116H possibly damaging Het
Gm9376 A T 14: 118,504,502 (GRCm39) probably benign Het
Golim4 A T 3: 75,813,775 (GRCm39) F150I probably damaging Het
Gtpbp2 G A 17: 46,478,757 (GRCm39) V525M probably damaging Het
Hook1 A G 4: 95,901,499 (GRCm39) N486D probably benign Het
Hook1 A G 4: 95,903,049 (GRCm39) S513G probably benign Het
Hoxd9 A T 2: 74,528,415 (GRCm39) T6S probably damaging Het
Hsd3b2 A T 3: 98,619,051 (GRCm39) L298Q possibly damaging Het
Idh3b A C 2: 130,123,572 (GRCm39) S172A probably benign Het
Ifnar1 C T 16: 91,292,367 (GRCm39) P207L probably benign Het
Ighv5-17 T A 12: 113,822,858 (GRCm39) T88S possibly damaging Het
Il16 T A 7: 83,337,380 (GRCm39) K112* probably null Het
Irag1 A T 7: 110,545,161 (GRCm39) I45N possibly damaging Het
Kalrn T A 16: 33,805,600 (GRCm39) I2646F probably benign Het
Kcnt1 G T 2: 25,767,959 (GRCm39) G23C probably damaging Het
Kirrel2 T A 7: 30,150,260 (GRCm39) I523F probably damaging Het
Lrrc3b A T 14: 15,358,552 (GRCm38) L18H probably damaging Het
Med13l T A 5: 118,862,214 (GRCm39) S386T probably benign Het
Mettl6 C T 14: 31,209,527 (GRCm39) probably null Het
Mocs2 C T 13: 114,961,879 (GRCm39) A120V possibly damaging Het
Mrpl39 T C 16: 84,531,346 (GRCm39) T74A probably benign Het
Myh2 T C 11: 67,069,754 (GRCm39) F367L probably damaging Het
N4bp1 G A 8: 87,587,238 (GRCm39) Q567* probably null Het
Naf1 A G 8: 67,336,097 (GRCm39) I341M probably damaging Het
Ncoa6 A T 2: 155,250,063 (GRCm39) N1080K probably benign Het
Nell1 C A 7: 49,632,474 (GRCm39) L36I possibly damaging Het
Nrxn2 A G 19: 6,522,448 (GRCm39) D446G probably damaging Het
Nrxn3 T A 12: 89,499,737 (GRCm39) C709* probably null Het
Or13p4 T G 4: 118,547,416 (GRCm39) T78P probably damaging Het
Or2ag17 A G 7: 106,389,464 (GRCm39) V248A probably damaging Het
Or2n1 A C 17: 38,486,694 (GRCm39) T240P probably damaging Het
Or2t26 C G 11: 49,039,879 (GRCm39) A265G probably benign Het
Or8g19 T A 9: 39,055,766 (GRCm39) Y123* probably null Het
Ovgp1 T C 3: 105,893,883 (GRCm39) probably benign Het
Pbx3 A G 2: 34,114,555 (GRCm39) probably benign Het
Pcnx1 T C 12: 81,964,981 (GRCm39) S383P probably damaging Het
Pde6h T G 6: 136,936,359 (GRCm39) F34C probably damaging Het
Pnliprp1 A G 19: 58,720,628 (GRCm39) probably benign Het
Pramel21 T C 4: 143,343,795 (GRCm39) L365P probably damaging Het
Prl8a9 C T 13: 27,748,498 (GRCm39) probably null Het
Qdpr T C 5: 45,596,669 (GRCm39) N165S probably benign Het
Rabl2 A G 15: 89,468,148 (GRCm39) F158L probably damaging Het
Rrp7a G T 15: 83,004,084 (GRCm39) C117* probably null Het
Ryr2 T C 13: 11,787,463 (GRCm39) Y970C probably damaging Het
Sf3b3 T C 8: 111,552,774 (GRCm39) T503A possibly damaging Het
Sipa1 T C 19: 5,704,198 (GRCm39) E708G probably damaging Het
Skor2 T A 18: 76,948,811 (GRCm39) S844R possibly damaging Het
Slc6a7 C T 18: 61,138,815 (GRCm39) C231Y probably damaging Het
Smgc A T 15: 91,729,665 (GRCm39) E206D probably benign Het
Tanc2 T C 11: 105,758,290 (GRCm39) S684P possibly damaging Het
Tep1 T C 14: 51,082,967 (GRCm39) T1014A possibly damaging Het
Tex19.1 A G 11: 121,038,283 (GRCm39) S214G probably benign Het
Trmt6 G A 2: 132,650,774 (GRCm39) S278L probably benign Het
Use1 T C 8: 71,821,200 (GRCm39) S156P probably benign Het
Znrf1 G A 8: 112,335,954 (GRCm39) V152M probably damaging Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 119,846,076 (GRCm39) missense probably damaging 1.00
IGL00800:Abca14 APN 7 119,854,613 (GRCm39) missense probably benign 0.01
IGL00845:Abca14 APN 7 119,823,174 (GRCm39) splice site probably benign
IGL00897:Abca14 APN 7 119,815,348 (GRCm39) splice site probably benign
IGL01524:Abca14 APN 7 119,852,644 (GRCm39) missense possibly damaging 0.57
IGL01747:Abca14 APN 7 119,877,310 (GRCm39) missense probably benign 0.00
IGL02214:Abca14 APN 7 119,893,398 (GRCm39) missense probably benign 0.09
IGL02215:Abca14 APN 7 119,852,612 (GRCm39) missense probably benign 0.00
IGL02253:Abca14 APN 7 119,807,182 (GRCm39) missense probably benign 0.29
IGL02302:Abca14 APN 7 119,917,968 (GRCm39) splice site probably benign
IGL03391:Abca14 APN 7 119,846,107 (GRCm39) missense probably damaging 1.00
F6893:Abca14 UTSW 7 119,924,261 (GRCm39) missense probably damaging 0.98
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0265:Abca14 UTSW 7 119,822,850 (GRCm39) missense probably benign 0.03
R0326:Abca14 UTSW 7 119,823,642 (GRCm39) missense probably damaging 1.00
R0380:Abca14 UTSW 7 119,877,703 (GRCm39) missense probably benign 0.03
R0418:Abca14 UTSW 7 119,806,657 (GRCm39) missense probably damaging 1.00
R0539:Abca14 UTSW 7 119,807,020 (GRCm39) missense probably damaging 1.00
R0574:Abca14 UTSW 7 119,823,720 (GRCm39) missense probably damaging 0.96
R0611:Abca14 UTSW 7 119,851,479 (GRCm39) missense possibly damaging 0.63
R0783:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0785:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0863:Abca14 UTSW 7 119,815,453 (GRCm39) missense probably benign 0.03
R1034:Abca14 UTSW 7 119,815,370 (GRCm39) missense probably damaging 1.00
R1056:Abca14 UTSW 7 119,924,295 (GRCm39) missense probably damaging 1.00
R1072:Abca14 UTSW 7 119,811,992 (GRCm39) missense probably benign
R1244:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1255:Abca14 UTSW 7 119,807,016 (GRCm39) missense probably damaging 0.97
R1271:Abca14 UTSW 7 119,924,340 (GRCm39) missense probably damaging 1.00
R1325:Abca14 UTSW 7 119,846,545 (GRCm39) missense probably benign 0.32
R1457:Abca14 UTSW 7 119,888,683 (GRCm39) missense probably benign 0.00
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1494:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R1551:Abca14 UTSW 7 119,918,101 (GRCm39) missense probably benign 0.10
R1607:Abca14 UTSW 7 119,850,514 (GRCm39) missense probably damaging 1.00
R1739:Abca14 UTSW 7 119,877,529 (GRCm39) missense probably benign 0.04
R1856:Abca14 UTSW 7 119,877,404 (GRCm39) missense probably damaging 1.00
R1875:Abca14 UTSW 7 119,847,190 (GRCm39) missense possibly damaging 0.78
R1892:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1898:Abca14 UTSW 7 119,850,392 (GRCm39) missense probably damaging 1.00
R1958:Abca14 UTSW 7 119,924,382 (GRCm39) missense probably damaging 0.98
R2018:Abca14 UTSW 7 119,815,408 (GRCm39) missense probably benign 0.00
R2039:Abca14 UTSW 7 119,911,487 (GRCm39) missense probably damaging 0.98
R2060:Abca14 UTSW 7 119,826,741 (GRCm39) nonsense probably null
R2202:Abca14 UTSW 7 119,888,764 (GRCm39) missense probably benign 0.17
R2205:Abca14 UTSW 7 119,846,503 (GRCm39) missense probably damaging 0.98
R2360:Abca14 UTSW 7 119,850,431 (GRCm39) missense probably benign 0.00
R2401:Abca14 UTSW 7 119,882,312 (GRCm39) missense probably damaging 1.00
R2426:Abca14 UTSW 7 119,882,446 (GRCm39) missense probably benign 0.04
R3433:Abca14 UTSW 7 119,893,455 (GRCm39) missense probably damaging 0.97
R4598:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4599:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4700:Abca14 UTSW 7 119,911,928 (GRCm39) critical splice donor site probably null
R4751:Abca14 UTSW 7 119,911,400 (GRCm39) missense probably benign 0.01
R4826:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4828:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4837:Abca14 UTSW 7 119,846,203 (GRCm39) missense probably benign
R4881:Abca14 UTSW 7 119,877,472 (GRCm39) missense possibly damaging 0.49
R4895:Abca14 UTSW 7 119,846,572 (GRCm39) critical splice donor site probably null
R4928:Abca14 UTSW 7 119,923,803 (GRCm39) missense possibly damaging 0.90
R4990:Abca14 UTSW 7 119,911,388 (GRCm39) missense probably benign 0.00
R5027:Abca14 UTSW 7 119,911,505 (GRCm39) missense probably benign 0.05
R5091:Abca14 UTSW 7 119,851,497 (GRCm39) missense probably damaging 1.00
R5158:Abca14 UTSW 7 119,852,652 (GRCm39) missense probably benign
R5209:Abca14 UTSW 7 119,832,130 (GRCm39) missense probably benign 0.01
R5333:Abca14 UTSW 7 119,888,769 (GRCm39) nonsense probably null
R5424:Abca14 UTSW 7 119,810,777 (GRCm39) missense probably benign 0.01
R5488:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5489:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5716:Abca14 UTSW 7 119,846,217 (GRCm39) critical splice donor site probably null
R6450:Abca14 UTSW 7 119,815,449 (GRCm39) missense probably benign 0.17
R6477:Abca14 UTSW 7 119,924,325 (GRCm39) missense probably benign 0.44
R6652:Abca14 UTSW 7 119,846,164 (GRCm39) missense probably damaging 1.00
R6782:Abca14 UTSW 7 119,847,308 (GRCm39) missense probably damaging 1.00
R6874:Abca14 UTSW 7 119,851,428 (GRCm39) missense possibly damaging 0.71
R6965:Abca14 UTSW 7 119,882,452 (GRCm39) nonsense probably null
R7142:Abca14 UTSW 7 119,850,406 (GRCm39) missense possibly damaging 0.89
R7146:Abca14 UTSW 7 119,854,520 (GRCm39) missense probably benign 0.15
R7202:Abca14 UTSW 7 119,917,236 (GRCm39) missense probably damaging 1.00
R7220:Abca14 UTSW 7 119,826,667 (GRCm39) missense possibly damaging 0.45
R7241:Abca14 UTSW 7 119,846,184 (GRCm39) missense probably damaging 1.00
R7291:Abca14 UTSW 7 119,888,832 (GRCm39) nonsense probably null
R7296:Abca14 UTSW 7 119,877,534 (GRCm39) missense probably benign
R7298:Abca14 UTSW 7 119,807,106 (GRCm39) missense probably benign 0.00
R7315:Abca14 UTSW 7 119,893,341 (GRCm39) missense probably benign 0.00
R7776:Abca14 UTSW 7 119,832,214 (GRCm39) critical splice donor site probably null
R7820:Abca14 UTSW 7 119,811,944 (GRCm39) missense probably benign 0.42
R7873:Abca14 UTSW 7 119,888,792 (GRCm39) missense probably benign 0.17
R8215:Abca14 UTSW 7 119,893,425 (GRCm39) missense probably benign
R8332:Abca14 UTSW 7 119,815,436 (GRCm39) missense probably benign
R8419:Abca14 UTSW 7 119,815,489 (GRCm39) missense probably benign 0.08
R8444:Abca14 UTSW 7 119,918,133 (GRCm39) missense probably damaging 1.00
R8818:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R8834:Abca14 UTSW 7 119,877,372 (GRCm39) missense probably benign 0.02
R8845:Abca14 UTSW 7 119,846,428 (GRCm39) missense probably benign 0.00
R8889:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8892:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8894:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably damaging 1.00
R8903:Abca14 UTSW 7 119,815,526 (GRCm39) missense probably damaging 0.98
R8950:Abca14 UTSW 7 119,823,595 (GRCm39) missense possibly damaging 0.92
R8950:Abca14 UTSW 7 119,823,644 (GRCm39) nonsense probably null
R9018:Abca14 UTSW 7 119,918,532 (GRCm39) missense probably damaging 0.98
R9018:Abca14 UTSW 7 119,888,763 (GRCm39) missense probably benign 0.01
R9110:Abca14 UTSW 7 119,831,615 (GRCm39) intron probably benign
R9254:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9376:Abca14 UTSW 7 119,893,438 (GRCm39) missense probably damaging 1.00
R9378:Abca14 UTSW 7 119,807,191 (GRCm39) missense possibly damaging 0.64
R9379:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9388:Abca14 UTSW 7 119,882,261 (GRCm39) missense probably benign 0.01
R9522:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably null 0.98
R9577:Abca14 UTSW 7 119,810,768 (GRCm39) missense probably benign 0.27
R9627:Abca14 UTSW 7 119,854,530 (GRCm39) missense probably benign 0.00
R9639:Abca14 UTSW 7 119,893,345 (GRCm39) missense probably benign 0.01
R9660:Abca14 UTSW 7 119,851,478 (GRCm39) missense probably benign 0.00
R9696:Abca14 UTSW 7 119,888,734 (GRCm39) missense possibly damaging 0.59
R9709:Abca14 UTSW 7 119,888,739 (GRCm39) nonsense probably null
R9780:Abca14 UTSW 7 119,911,447 (GRCm39) missense probably benign 0.00
Z1088:Abca14 UTSW 7 119,815,358 (GRCm39) missense probably benign 0.14
Z1176:Abca14 UTSW 7 119,846,146 (GRCm39) missense probably damaging 1.00
Z1177:Abca14 UTSW 7 119,917,210 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTATCTCTCTGGCCCTGATG -3'
(R):5'- GAAGTGGATGATGAGGTCCC -3'

Sequencing Primer
(F):5'- CCTGATGCCACCATTACAGTC -3'
(R):5'- TGGATGATGAGGTCCCACAGC -3'
Posted On 2022-06-15