Incidental Mutation 'R9445:Eef2k'
ID 713881
Institutional Source Beutler Lab
Gene Symbol Eef2k
Ensembl Gene ENSMUSG00000035064
Gene Name eukaryotic elongation factor-2 kinase
Synonyms eEF-2K
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R9445 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 120842831-120907450 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120858471 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 18 (C18R)
Ref Sequence ENSEMBL: ENSMUSP00000046595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047875] [ENSMUST00000106488] [ENSMUST00000106489] [ENSMUST00000143279] [ENSMUST00000143322]
AlphaFold O08796
Predicted Effect probably benign
Transcript: ENSMUST00000047875
AA Change: C18R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046595
Gene: ENSMUSG00000035064
AA Change: C18R

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 525 562 7.2e-5 PFAM
Pfam:Sel1 564 608 2.9e-3 PFAM
Pfam:Sel1 609 645 1.3e-1 PFAM
Pfam:Sel1 665 699 1.2e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106488
AA Change: C18R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102097
Gene: ENSMUSG00000035064
AA Change: C18R

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106489
AA Change: C18R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102098
Gene: ENSMUSG00000035064
AA Change: C18R

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143279
AA Change: C18R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000143322
AA Change: C18R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115486
Gene: ENSMUSG00000035064
AA Change: C18R

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 6e-15 BLAST
Blast:Alpha_kinase 120 160 1e-21 BLAST
SCOP:d1ia9a_ 129 160 3e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein kinase in the calmodulin-mediated signaling pathway that links activation of cell surface receptors to cell division. This kinase is involved in the regulation of protein synthesis. It phosphorylates eukaryotic elongation factor 2 (EEF2) and thus inhibits the EEF2 function. The activity of this kinase is increased in many cancers and may be a valid target for anti-cancer treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired regulation of ovarian follicular degeneration and apoptosis, prolonged estrus, and increased ovarian follicle numbers in aged females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T A 14: 41,996,217 H23Q possibly damaging Het
Abca14 T C 7: 120,278,468 S1069P probably benign Het
Abo A G 2: 26,843,708 W160R probably damaging Het
Ahnak2 T C 12: 112,781,355 Q1624R Het
Amy2a1 T A 3: 113,531,675 N90I possibly damaging Het
Bod1l C T 5: 41,817,276 V2232I probably benign Het
Brsk2 T A 7: 141,984,412 H98Q probably damaging Het
Caskin2 C T 11: 115,803,750 V342I probably damaging Het
Ccdc13 T C 9: 121,798,090 N707S probably benign Het
Cdv3 T C 9: 103,364,041 E109G probably damaging Het
Coro2a C T 4: 46,540,558 E454K probably benign Het
Cpq A T 15: 33,213,245 I137F possibly damaging Het
Ctsj G A 13: 61,004,024 T73I possibly damaging Het
Dchs2 A G 3: 83,238,977 D710G probably damaging Het
Drd4 T C 7: 141,292,249 V71A probably damaging Het
Ercc4 C A 16: 13,127,610 D386E probably benign Het
F2rl2 A C 13: 95,701,114 L222F probably benign Het
Fkbp4 T C 6: 128,436,617 D68G probably damaging Het
Fsip2 A T 2: 82,975,788 D817V probably damaging Het
Gm13083 T C 4: 143,617,225 L365P probably damaging Het
Gm19410 G A 8: 35,772,498 R116H possibly damaging Het
Gm9376 A T 14: 118,267,090 probably benign Het
Golim4 A T 3: 75,906,468 F150I probably damaging Het
Gtpbp2 G A 17: 46,167,831 V525M probably damaging Het
Hook1 A G 4: 96,013,262 N486D probably benign Het
Hook1 A G 4: 96,014,812 S513G probably benign Het
Hoxd9 A T 2: 74,698,071 T6S probably damaging Het
Hsd3b2 A T 3: 98,711,735 L298Q possibly damaging Het
Idh3b A C 2: 130,281,652 S172A probably benign Het
Ifnar1 C T 16: 91,495,479 P207L probably benign Het
Ighv5-17 T A 12: 113,859,238 T88S possibly damaging Het
Il16 T A 7: 83,688,172 K112* probably null Het
Kalrn T A 16: 33,985,230 I2646F probably benign Het
Kcnt1 G T 2: 25,877,947 G23C probably damaging Het
Kirrel2 T A 7: 30,450,835 I523F probably damaging Het
Lrrc3b A T 14: 15,358,552 L18H probably damaging Het
Med13l T A 5: 118,724,149 S386T probably benign Het
Mettl6 C T 14: 31,487,570 probably null Het
Mocs2 C T 13: 114,825,343 A120V possibly damaging Het
Mrpl39 T C 16: 84,734,458 T74A probably benign Het
Mrvi1 A T 7: 110,945,954 I45N possibly damaging Het
Myh2 T C 11: 67,178,928 F367L probably damaging Het
N4bp1 G A 8: 86,860,610 Q567* probably null Het
Naf1 A G 8: 66,883,445 I341M probably damaging Het
Ncoa6 A T 2: 155,408,143 N1080K probably benign Het
Nell1 C A 7: 49,982,726 L36I possibly damaging Het
Nrxn2 A G 19: 6,472,418 D446G probably damaging Het
Nrxn3 T A 12: 89,532,967 C709* probably null Het
Olfr134 A C 17: 38,175,803 T240P probably damaging Het
Olfr1342 T G 4: 118,690,219 T78P probably damaging Het
Olfr1395 C G 11: 49,149,052 A265G probably benign Het
Olfr27 T A 9: 39,144,470 Y123* probably null Het
Olfr699 A G 7: 106,790,257 V248A probably damaging Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pcnx T C 12: 81,918,207 S383P probably damaging Het
Pde6h T G 6: 136,959,361 F34C probably damaging Het
Prl8a9 C T 13: 27,564,515 probably null Het
Qdpr T C 5: 45,439,327 N165S probably benign Het
Rabl2 A G 15: 89,583,945 F158L probably damaging Het
Ryr2 T C 13: 11,772,577 Y970C probably damaging Het
Sf3b3 T C 8: 110,826,142 T503A possibly damaging Het
Sipa1 T C 19: 5,654,170 E708G probably damaging Het
Skor2 T A 18: 76,861,116 S844R possibly damaging Het
Slc6a7 C T 18: 61,005,743 C231Y probably damaging Het
Smgc A T 15: 91,845,462 E206D probably benign Het
Tanc2 T C 11: 105,867,464 S684P possibly damaging Het
Tep1 T C 14: 50,845,510 T1014A possibly damaging Het
Tex19.1 A G 11: 121,147,457 S214G probably benign Het
Trmt6 G A 2: 132,808,854 S278L probably benign Het
Use1 T C 8: 71,368,556 S156P probably benign Het
Znrf1 G A 8: 111,609,322 V152M probably damaging Het
Other mutations in Eef2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Eef2k APN 7 120884815 unclassified probably benign
IGL01481:Eef2k APN 7 120895218 missense probably benign 0.23
IGL01935:Eef2k APN 7 120885831 missense probably damaging 1.00
IGL03109:Eef2k APN 7 120891726 missense probably damaging 1.00
R0458:Eef2k UTSW 7 120903290 missense probably damaging 0.99
R1639:Eef2k UTSW 7 120885828 missense probably damaging 1.00
R1986:Eef2k UTSW 7 120873346 missense possibly damaging 0.92
R3419:Eef2k UTSW 7 120885870 missense probably damaging 0.99
R3610:Eef2k UTSW 7 120889235 missense probably benign
R3707:Eef2k UTSW 7 120884712 missense probably damaging 1.00
R3856:Eef2k UTSW 7 120899371 nonsense probably null
R4024:Eef2k UTSW 7 120858598 missense probably benign 0.01
R4535:Eef2k UTSW 7 120858599 nonsense probably null
R4885:Eef2k UTSW 7 120891932 missense probably benign
R5137:Eef2k UTSW 7 120885422 missense probably damaging 0.99
R5137:Eef2k UTSW 7 120885423 missense probably damaging 1.00
R5501:Eef2k UTSW 7 120889248 missense probably benign 0.00
R5610:Eef2k UTSW 7 120886782 missense probably benign 0.00
R5633:Eef2k UTSW 7 120873290 intron probably benign
R7002:Eef2k UTSW 7 120891932 missense probably benign
R7166:Eef2k UTSW 7 120884772 missense probably damaging 1.00
R7254:Eef2k UTSW 7 120889265 missense probably benign 0.11
R7466:Eef2k UTSW 7 120903484 splice site probably null
R7486:Eef2k UTSW 7 120858570 missense probably benign
R7538:Eef2k UTSW 7 120891992 missense probably benign 0.29
R7593:Eef2k UTSW 7 120889268 critical splice donor site probably null
R7675:Eef2k UTSW 7 120858504 missense probably benign
R7815:Eef2k UTSW 7 120858570 missense probably benign
R7898:Eef2k UTSW 7 120895218 missense probably damaging 1.00
R8182:Eef2k UTSW 7 120873403 missense probably damaging 1.00
R8288:Eef2k UTSW 7 120903381 missense probably damaging 1.00
R8495:Eef2k UTSW 7 120887880 missense probably benign 0.00
R8807:Eef2k UTSW 7 120891707 missense possibly damaging 0.69
R8881:Eef2k UTSW 7 120873325 missense probably damaging 1.00
R8949:Eef2k UTSW 7 120891988 missense probably damaging 0.99
R9044:Eef2k UTSW 7 120880361 missense probably damaging 1.00
R9074:Eef2k UTSW 7 120891901 missense probably damaging 1.00
R9332:Eef2k UTSW 7 120884695 missense probably benign 0.00
R9605:Eef2k UTSW 7 120891947 missense probably damaging 1.00
R9777:Eef2k UTSW 7 120900230 critical splice acceptor site probably benign
Z1177:Eef2k UTSW 7 120858453 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCAGGTACCTAGACAACCC -3'
(R):5'- AACACTCACCTTGAAGTGGAAGG -3'

Sequencing Primer
(F):5'- TAGACAACCCTCACGTCTGTC -3'
(R):5'- TCACCTTGAAGTGGAAGGAGCTG -3'
Posted On 2022-06-15