Incidental Mutation 'R9446:Cacna1s'
ID 713927
Institutional Source Beutler Lab
Gene Symbol Cacna1s
Ensembl Gene ENSMUSG00000026407
Gene Name calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms mdg, muscle dysgenesis, sj, Cav1.1, Cchl1a3, DHPR alpha1s, fmd
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9446 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 135980549-136047268 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 136045362 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1670 (E1670G)
Ref Sequence ENSEMBL: ENSMUSP00000107699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112064] [ENSMUST00000112068] [ENSMUST00000160641] [ENSMUST00000161865]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000112064
AA Change: E1689G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107695
Gene: ENSMUSG00000026407
AA Change: E1689G

DomainStartEndE-ValueType
Pfam:Ion_trans 50 345 4.3e-68 PFAM
Pfam:Ion_trans 431 672 4.5e-56 PFAM
Pfam:PKD_channel 516 667 1.9e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
Pfam:Ion_trans 798 1076 2.6e-65 PFAM
Pfam:Ion_trans 1117 1392 1.2e-71 PFAM
Pfam:PKD_channel 1126 1387 8.4e-13 PFAM
Pfam:GPHH 1394 1463 2.3e-38 PFAM
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Pfam:CAC1F_C 1756 1845 2.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112068
AA Change: E1670G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107699
Gene: ENSMUSG00000026407
AA Change: E1670G

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.1e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.7e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 3.9e-53 PFAM
Pfam:Ion_trans 1152 1361 6.7e-66 PFAM
Pfam:PKD_channel 1201 1368 8.4e-10 PFAM
Blast:EFh 1382 1410 5e-8 BLAST
Ca_chan_IQ 1496 1529 3.71e-14 SMART
low complexity region 1638 1650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160641
AA Change: E1689G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125278
Gene: ENSMUSG00000026407
AA Change: E1689G

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.3e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.8e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 4e-53 PFAM
Pfam:PKD_channel 1126 1387 6.1e-12 PFAM
Pfam:Ion_trans 1152 1380 9e-65 PFAM
Blast:EFh 1401 1429 5e-8 BLAST
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161865
AA Change: E1423G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125262
Gene: ENSMUSG00000026407
AA Change: E1423G

DomainStartEndE-ValueType
Pfam:Ion_trans 3 98 1.1e-21 PFAM
Pfam:Ion_trans 184 425 3.3e-56 PFAM
Pfam:PKD_channel 267 420 1.8e-7 PFAM
low complexity region 428 438 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
Pfam:Ion_trans 551 829 1.9e-65 PFAM
Pfam:Ion_trans 870 1126 5.4e-72 PFAM
Pfam:PKD_channel 954 1121 7.2e-10 PFAM
Pfam:GPHH 1128 1197 1.8e-38 PFAM
Ca_chan_IQ 1249 1282 3.71e-14 SMART
low complexity region 1391 1403 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the five subunits of the slowly inactivating L-type voltage-dependent calcium channel in skeletal muscle cells. Mutations in this gene have been associated with hypokalemic periodic paralysis, thyrotoxic periodic paralysis and malignant hyperthermia susceptibility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show edema and failure of myoblast differentiation by day 13 of embryonic development and die perinatally. All muscles degenerate and additional secondary anomalies of the skeleton, short jaw, and cleft palate are seen. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Spontaneous(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T G 2: 120,976,530 (GRCm39) I90S probably null Het
Adck2 G T 6: 39,551,221 (GRCm39) probably benign Het
Adgrf3 G T 5: 30,401,957 (GRCm39) D690E probably benign Het
Aff3 C T 1: 38,574,337 (GRCm39) G175S probably benign Het
Atf7 T C 15: 102,459,923 (GRCm39) H159R probably damaging Het
BB014433 GGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGGGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGGGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,091,810 (GRCm39) probably benign Het
Birc6 A G 17: 74,925,491 (GRCm39) K2241R probably damaging Het
Clca4b C T 3: 144,638,134 (GRCm39) A43T probably benign Het
Clock T A 5: 76,396,288 (GRCm39) I154L probably benign Het
Dnah10 A T 5: 124,823,677 (GRCm39) D566V probably damaging Het
Eml1 T C 12: 108,481,465 (GRCm39) W443R probably damaging Het
Ghitm A G 14: 36,853,606 (GRCm39) I78T possibly damaging Het
Gm4181 A T 14: 51,873,062 (GRCm39) M1K probably null Het
Gm9195 T C 14: 72,717,957 (GRCm39) Y187C probably damaging Het
Htt A G 5: 34,919,272 (GRCm39) M8V probably benign Het
Ighv1-9 T C 12: 114,547,388 (GRCm39) Y51C probably benign Het
Kif13b G A 14: 64,984,470 (GRCm39) E636K probably damaging Het
Mamdc4 T A 2: 25,453,645 (GRCm39) M1179L probably benign Het
Map3k4 G A 17: 12,451,375 (GRCm39) A1506V probably damaging Het
Mbtd1 T C 11: 93,834,508 (GRCm39) S622P unknown Het
Med13l T A 5: 118,876,567 (GRCm39) D914E probably benign Het
Mettl9 T A 7: 120,675,531 (GRCm39) D310E possibly damaging Het
Myh13 T G 11: 67,255,325 (GRCm39) V1565G probably benign Het
Nrf1 A G 6: 30,090,019 (GRCm39) T33A probably damaging Het
Oas1d A G 5: 121,054,947 (GRCm39) K173R probably benign Het
Or12e10 A T 2: 87,640,199 (GRCm39) M12L probably benign Het
Or1e34 T A 11: 73,778,530 (GRCm39) T223S probably benign Het
Or4k6 A G 14: 50,475,974 (GRCm39) Y123H probably damaging Het
Or8g54 A T 9: 39,707,342 (GRCm39) S224C probably damaging Het
Pde6a T A 18: 61,419,067 (GRCm39) D814E probably benign Het
Pilrb2 T C 5: 137,869,429 (GRCm39) D57G possibly damaging Het
Psg21 T A 7: 18,388,865 (GRCm39) T76S probably benign Het
Ralgapa1 A G 12: 55,754,808 (GRCm39) V1161A probably damaging Het
Rtl1 C G 12: 109,556,604 (GRCm39) *1745S probably null Het
Samd8 T C 14: 21,833,769 (GRCm39) C296R Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,957,756 (GRCm39) probably benign Het
Sfmbt1 T C 14: 30,506,697 (GRCm39) I247T possibly damaging Het
Smarca4 G A 9: 21,547,155 (GRCm39) A227T unknown Het
Trmt6 G A 2: 132,650,774 (GRCm39) S278L probably benign Het
Trpm6 T C 19: 18,815,462 (GRCm39) S1183P possibly damaging Het
Trpm7 T A 2: 126,672,185 (GRCm39) probably null Het
Wnt10a C A 1: 74,842,728 (GRCm39) F401L possibly damaging Het
Zfp970 A T 2: 177,167,064 (GRCm39) K213* probably null Het
Other mutations in Cacna1s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Cacna1s APN 1 136,012,011 (GRCm39) nonsense probably null
IGL00517:Cacna1s APN 1 136,015,077 (GRCm39) missense probably damaging 1.00
IGL01316:Cacna1s APN 1 136,046,702 (GRCm39) missense probably benign 0.01
IGL01348:Cacna1s APN 1 136,002,890 (GRCm39) missense possibly damaging 0.95
IGL01739:Cacna1s APN 1 136,024,870 (GRCm39) critical splice donor site probably null
IGL01773:Cacna1s APN 1 136,046,491 (GRCm39) missense probably benign 0.32
IGL02056:Cacna1s APN 1 136,046,738 (GRCm39) missense probably benign
IGL02262:Cacna1s APN 1 136,035,867 (GRCm39) missense probably damaging 0.98
IGL02324:Cacna1s APN 1 136,002,914 (GRCm39) splice site probably benign
IGL02352:Cacna1s APN 1 136,020,990 (GRCm39) splice site probably benign
IGL02359:Cacna1s APN 1 136,020,990 (GRCm39) splice site probably benign
IGL02370:Cacna1s APN 1 136,013,085 (GRCm39) missense probably damaging 1.00
IGL02377:Cacna1s APN 1 135,996,732 (GRCm39) missense probably damaging 1.00
IGL02474:Cacna1s APN 1 136,046,118 (GRCm39) missense probably benign
IGL02606:Cacna1s APN 1 136,007,257 (GRCm39) missense probably damaging 0.99
IGL02833:Cacna1s APN 1 135,998,743 (GRCm39) missense probably benign 0.03
IGL02974:Cacna1s APN 1 136,020,355 (GRCm39) missense possibly damaging 0.78
IGL03064:Cacna1s APN 1 136,039,731 (GRCm39) missense probably damaging 1.00
IGL03093:Cacna1s APN 1 136,043,802 (GRCm39) missense probably benign 0.00
IGL03286:Cacna1s APN 1 136,005,397 (GRCm39) missense probably benign
brookstone UTSW 1 136,020,432 (GRCm39) missense probably benign 0.01
flyfish UTSW 1 136,043,799 (GRCm39) missense probably benign 0.21
forelle UTSW 1 136,023,596 (GRCm39) missense probably damaging 0.99
river UTSW 1 136,033,582 (GRCm39) missense possibly damaging 0.88
stream UTSW 1 136,033,552 (GRCm39) missense probably damaging 1.00
BB009:Cacna1s UTSW 1 136,012,097 (GRCm39) missense probably damaging 0.99
BB019:Cacna1s UTSW 1 136,012,097 (GRCm39) missense probably damaging 0.99
G1Funyon:Cacna1s UTSW 1 136,001,179 (GRCm39) unclassified probably benign
N/A:Cacna1s UTSW 1 136,001,247 (GRCm39) missense probably benign 0.00
R0030:Cacna1s UTSW 1 136,022,727 (GRCm39) critical splice donor site probably null
R0030:Cacna1s UTSW 1 136,022,727 (GRCm39) critical splice donor site probably null
R0097:Cacna1s UTSW 1 136,028,360 (GRCm39) missense possibly damaging 0.79
R0097:Cacna1s UTSW 1 136,028,360 (GRCm39) missense possibly damaging 0.79
R0240:Cacna1s UTSW 1 136,001,234 (GRCm39) unclassified probably benign
R0255:Cacna1s UTSW 1 136,046,544 (GRCm39) missense possibly damaging 0.93
R0302:Cacna1s UTSW 1 136,028,342 (GRCm39) missense probably benign 0.01
R0319:Cacna1s UTSW 1 135,998,455 (GRCm39) missense probably damaging 0.99
R0411:Cacna1s UTSW 1 136,041,041 (GRCm39) missense probably damaging 1.00
R0413:Cacna1s UTSW 1 136,025,947 (GRCm39) missense probably benign 0.00
R0482:Cacna1s UTSW 1 136,041,132 (GRCm39) missense probably benign
R0491:Cacna1s UTSW 1 136,016,746 (GRCm39) splice site probably benign
R0518:Cacna1s UTSW 1 136,004,597 (GRCm39) missense probably benign
R0717:Cacna1s UTSW 1 136,026,029 (GRCm39) missense probably damaging 1.00
R0725:Cacna1s UTSW 1 136,026,264 (GRCm39) splice site probably benign
R0815:Cacna1s UTSW 1 136,040,695 (GRCm39) missense possibly damaging 0.95
R1384:Cacna1s UTSW 1 136,022,709 (GRCm39) missense probably benign 0.02
R1518:Cacna1s UTSW 1 136,026,289 (GRCm39) missense probably damaging 1.00
R1548:Cacna1s UTSW 1 136,038,675 (GRCm39) missense probably damaging 1.00
R1725:Cacna1s UTSW 1 136,026,361 (GRCm39) missense probably damaging 1.00
R1728:Cacna1s UTSW 1 136,046,454 (GRCm39) missense probably benign
R1729:Cacna1s UTSW 1 136,046,454 (GRCm39) missense probably benign
R1730:Cacna1s UTSW 1 136,046,454 (GRCm39) missense probably benign
R1739:Cacna1s UTSW 1 136,046,454 (GRCm39) missense probably benign
R1762:Cacna1s UTSW 1 136,046,454 (GRCm39) missense probably benign
R1783:Cacna1s UTSW 1 136,046,454 (GRCm39) missense probably benign
R1784:Cacna1s UTSW 1 136,046,454 (GRCm39) missense probably benign
R1785:Cacna1s UTSW 1 136,046,454 (GRCm39) missense probably benign
R1800:Cacna1s UTSW 1 136,004,592 (GRCm39) missense probably benign
R1924:Cacna1s UTSW 1 136,016,755 (GRCm39) splice site probably null
R1969:Cacna1s UTSW 1 136,046,833 (GRCm39) missense probably benign 0.42
R2072:Cacna1s UTSW 1 136,007,242 (GRCm39) missense probably benign
R2380:Cacna1s UTSW 1 136,023,586 (GRCm39) missense probably damaging 1.00
R3110:Cacna1s UTSW 1 136,002,831 (GRCm39) nonsense probably null
R3112:Cacna1s UTSW 1 136,002,831 (GRCm39) nonsense probably null
R3151:Cacna1s UTSW 1 136,033,532 (GRCm39) missense probably damaging 1.00
R3696:Cacna1s UTSW 1 136,033,552 (GRCm39) missense probably damaging 1.00
R3722:Cacna1s UTSW 1 135,996,780 (GRCm39) missense possibly damaging 0.77
R3804:Cacna1s UTSW 1 136,034,756 (GRCm39) missense possibly damaging 0.85
R3813:Cacna1s UTSW 1 136,013,085 (GRCm39) missense probably damaging 1.00
R3905:Cacna1s UTSW 1 136,012,007 (GRCm39) missense probably damaging 0.99
R3907:Cacna1s UTSW 1 136,012,007 (GRCm39) missense probably damaging 0.99
R3909:Cacna1s UTSW 1 136,012,007 (GRCm39) missense probably damaging 0.99
R4170:Cacna1s UTSW 1 136,035,933 (GRCm39) missense probably damaging 1.00
R4329:Cacna1s UTSW 1 136,046,771 (GRCm39) missense probably benign 0.00
R4485:Cacna1s UTSW 1 136,004,590 (GRCm39) missense probably damaging 1.00
R4581:Cacna1s UTSW 1 135,998,708 (GRCm39) splice site probably null
R4719:Cacna1s UTSW 1 136,046,390 (GRCm39) splice site probably benign
R4816:Cacna1s UTSW 1 136,043,007 (GRCm39) missense possibly damaging 0.89
R4909:Cacna1s UTSW 1 136,007,342 (GRCm39) missense probably damaging 0.99
R4917:Cacna1s UTSW 1 136,029,302 (GRCm39) critical splice donor site probably null
R5296:Cacna1s UTSW 1 136,023,523 (GRCm39) missense probably benign 0.11
R5411:Cacna1s UTSW 1 136,033,549 (GRCm39) missense probably benign 0.09
R5503:Cacna1s UTSW 1 136,014,480 (GRCm39) missense probably damaging 1.00
R5533:Cacna1s UTSW 1 136,026,113 (GRCm39) critical splice donor site probably null
R5714:Cacna1s UTSW 1 136,039,804 (GRCm39) missense probably benign 0.44
R5775:Cacna1s UTSW 1 136,035,860 (GRCm39) missense probably damaging 1.00
R5814:Cacna1s UTSW 1 136,034,880 (GRCm39) missense probably benign 0.31
R5820:Cacna1s UTSW 1 136,007,342 (GRCm39) missense probably damaging 1.00
R5822:Cacna1s UTSW 1 136,039,816 (GRCm39) missense probably damaging 1.00
R5877:Cacna1s UTSW 1 136,028,405 (GRCm39) missense probably damaging 0.99
R5923:Cacna1s UTSW 1 136,004,560 (GRCm39) missense possibly damaging 0.79
R6021:Cacna1s UTSW 1 136,034,225 (GRCm39) missense probably benign 0.15
R6037:Cacna1s UTSW 1 135,998,705 (GRCm39) missense possibly damaging 0.90
R6037:Cacna1s UTSW 1 135,998,705 (GRCm39) missense possibly damaging 0.90
R6056:Cacna1s UTSW 1 136,033,574 (GRCm39) missense probably damaging 1.00
R6143:Cacna1s UTSW 1 136,004,496 (GRCm39) missense probably damaging 0.99
R6222:Cacna1s UTSW 1 136,032,360 (GRCm39) missense probably benign 0.00
R6237:Cacna1s UTSW 1 136,033,582 (GRCm39) missense possibly damaging 0.88
R6274:Cacna1s UTSW 1 136,016,783 (GRCm39) missense probably benign 0.02
R6609:Cacna1s UTSW 1 136,041,129 (GRCm39) missense probably benign 0.30
R6626:Cacna1s UTSW 1 136,022,703 (GRCm39) missense probably damaging 1.00
R6838:Cacna1s UTSW 1 136,012,175 (GRCm39) missense possibly damaging 0.91
R6848:Cacna1s UTSW 1 136,020,432 (GRCm39) missense probably benign 0.01
R6849:Cacna1s UTSW 1 136,020,432 (GRCm39) missense probably benign 0.01
R6850:Cacna1s UTSW 1 136,020,432 (GRCm39) missense probably benign 0.01
R6851:Cacna1s UTSW 1 136,020,432 (GRCm39) missense probably benign 0.01
R6868:Cacna1s UTSW 1 136,020,432 (GRCm39) missense probably benign 0.01
R6879:Cacna1s UTSW 1 136,043,697 (GRCm39) missense probably benign 0.12
R6893:Cacna1s UTSW 1 136,005,431 (GRCm39) missense probably benign 0.05
R7017:Cacna1s UTSW 1 136,023,596 (GRCm39) missense probably damaging 0.99
R7228:Cacna1s UTSW 1 135,998,797 (GRCm39) missense possibly damaging 0.90
R7283:Cacna1s UTSW 1 136,001,446 (GRCm39) missense probably damaging 1.00
R7357:Cacna1s UTSW 1 135,998,759 (GRCm39) missense probably damaging 0.99
R7385:Cacna1s UTSW 1 136,020,371 (GRCm39) missense probably damaging 0.99
R7421:Cacna1s UTSW 1 136,014,540 (GRCm39) missense probably damaging 1.00
R7505:Cacna1s UTSW 1 136,013,187 (GRCm39) nonsense probably null
R7519:Cacna1s UTSW 1 135,998,494 (GRCm39) missense probably damaging 0.99
R7675:Cacna1s UTSW 1 136,038,612 (GRCm39) missense probably damaging 1.00
R7746:Cacna1s UTSW 1 135,996,756 (GRCm39) missense probably damaging 0.99
R7779:Cacna1s UTSW 1 136,046,767 (GRCm39) missense probably damaging 1.00
R7850:Cacna1s UTSW 1 135,998,786 (GRCm39) missense probably damaging 1.00
R7932:Cacna1s UTSW 1 136,012,097 (GRCm39) missense probably damaging 0.99
R7935:Cacna1s UTSW 1 136,020,333 (GRCm39) missense possibly damaging 0.62
R7950:Cacna1s UTSW 1 136,028,363 (GRCm39) missense probably benign 0.01
R7969:Cacna1s UTSW 1 136,004,470 (GRCm39) missense probably damaging 1.00
R8083:Cacna1s UTSW 1 136,023,529 (GRCm39) missense possibly damaging 0.91
R8101:Cacna1s UTSW 1 136,046,403 (GRCm39) missense probably benign 0.02
R8123:Cacna1s UTSW 1 136,035,917 (GRCm39) missense probably damaging 1.00
R8191:Cacna1s UTSW 1 136,035,893 (GRCm39) missense probably damaging 1.00
R8194:Cacna1s UTSW 1 136,005,430 (GRCm39) missense probably benign 0.33
R8251:Cacna1s UTSW 1 136,014,461 (GRCm39) missense probably damaging 1.00
R8265:Cacna1s UTSW 1 136,020,364 (GRCm39) nonsense probably null
R8301:Cacna1s UTSW 1 136,001,179 (GRCm39) unclassified probably benign
R8310:Cacna1s UTSW 1 136,015,075 (GRCm39) missense probably damaging 1.00
R8359:Cacna1s UTSW 1 136,043,799 (GRCm39) missense probably benign 0.21
R8461:Cacna1s UTSW 1 136,001,440 (GRCm39) missense possibly damaging 0.53
R8553:Cacna1s UTSW 1 136,019,540 (GRCm39) missense possibly damaging 0.93
R8743:Cacna1s UTSW 1 136,033,286 (GRCm39) missense probably damaging 1.00
R8766:Cacna1s UTSW 1 136,002,881 (GRCm39) missense probably damaging 1.00
R8884:Cacna1s UTSW 1 136,042,981 (GRCm39) missense probably benign 0.05
R8897:Cacna1s UTSW 1 136,045,392 (GRCm39) missense probably benign 0.01
R8939:Cacna1s UTSW 1 136,014,544 (GRCm39) critical splice donor site probably null
R8953:Cacna1s UTSW 1 136,025,170 (GRCm39) missense possibly damaging 0.94
R9039:Cacna1s UTSW 1 136,016,057 (GRCm39) missense probably benign
R9058:Cacna1s UTSW 1 135,998,436 (GRCm39) nonsense probably null
R9137:Cacna1s UTSW 1 135,996,744 (GRCm39) missense possibly damaging 0.89
R9332:Cacna1s UTSW 1 136,020,452 (GRCm39) nonsense probably null
R9416:Cacna1s UTSW 1 136,022,689 (GRCm39) missense possibly damaging 0.88
R9427:Cacna1s UTSW 1 136,012,090 (GRCm39) missense probably benign 0.30
R9564:Cacna1s UTSW 1 136,046,516 (GRCm39) missense probably benign
R9620:Cacna1s UTSW 1 136,035,909 (GRCm39) missense probably damaging 1.00
X0025:Cacna1s UTSW 1 136,043,708 (GRCm39) missense probably benign 0.00
Z1176:Cacna1s UTSW 1 136,034,822 (GRCm39) nonsense probably null
Z1177:Cacna1s UTSW 1 136,045,424 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAAGCAGCCGTGAGTTTG -3'
(R):5'- ATAGCGTGAACAAGCCTTCC -3'

Sequencing Primer
(F):5'- AGTTTGGCTTGCTCCCTCAGAG -3'
(R):5'- GAGCCTTCCTCAACCTGACGATAG -3'
Posted On 2022-06-15