Incidental Mutation 'R9446:Trpm7'
ID 713931
Institutional Source Beutler Lab
Gene Symbol Trpm7
Ensembl Gene ENSMUSG00000027365
Gene Name transient receptor potential cation channel, subfamily M, member 7
Synonyms CHAK, 5033407O22Rik, TRP-PLIK, 4833414K03Rik, CHAK1, LTRPC7, Ltpr7, 2310022G15Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9446 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 126633485-126718150 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 126672185 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028843] [ENSMUST00000103224]
AlphaFold Q923J1
PDB Structure CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (AMPPNP COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (ADP-MG COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (APO) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028843
SMART Domains Protein: ENSMUSP00000028843
Gene: ENSMUSG00000027365

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
Pfam:Ion_trans 887 1096 3e-8 PFAM
PDB:3E7K|H 1198 1249 6e-27 PDB
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1545 6e-64 BLAST
Alpha_kinase 1596 1813 3.77e-89 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103224
SMART Domains Protein: ENSMUSP00000099513
Gene: ENSMUSG00000027365

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
Pfam:Ion_trans 855 1108 1.7e-9 PFAM
Pfam:TRPM_tetra 1194 1249 3.3e-29 PFAM
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1546 2e-64 BLAST
Alpha_kinase 1597 1814 3.77e-89 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele display embryonic lehality. Mice with conditional deletion in developing thymocytes display a block in thymopoiesis. Mice homozygous for a kinase deleted allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit altered magnesium homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T G 2: 120,976,530 (GRCm39) I90S probably null Het
Adck2 G T 6: 39,551,221 (GRCm39) probably benign Het
Adgrf3 G T 5: 30,401,957 (GRCm39) D690E probably benign Het
Aff3 C T 1: 38,574,337 (GRCm39) G175S probably benign Het
Atf7 T C 15: 102,459,923 (GRCm39) H159R probably damaging Het
BB014433 GGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGGGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGGGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,091,810 (GRCm39) probably benign Het
Birc6 A G 17: 74,925,491 (GRCm39) K2241R probably damaging Het
Cacna1s A G 1: 136,045,362 (GRCm39) E1670G probably benign Het
Clca4b C T 3: 144,638,134 (GRCm39) A43T probably benign Het
Clock T A 5: 76,396,288 (GRCm39) I154L probably benign Het
Dnah10 A T 5: 124,823,677 (GRCm39) D566V probably damaging Het
Eml1 T C 12: 108,481,465 (GRCm39) W443R probably damaging Het
Ghitm A G 14: 36,853,606 (GRCm39) I78T possibly damaging Het
Gm4181 A T 14: 51,873,062 (GRCm39) M1K probably null Het
Gm9195 T C 14: 72,717,957 (GRCm39) Y187C probably damaging Het
Htt A G 5: 34,919,272 (GRCm39) M8V probably benign Het
Ighv1-9 T C 12: 114,547,388 (GRCm39) Y51C probably benign Het
Kif13b G A 14: 64,984,470 (GRCm39) E636K probably damaging Het
Mamdc4 T A 2: 25,453,645 (GRCm39) M1179L probably benign Het
Map3k4 G A 17: 12,451,375 (GRCm39) A1506V probably damaging Het
Mbtd1 T C 11: 93,834,508 (GRCm39) S622P unknown Het
Med13l T A 5: 118,876,567 (GRCm39) D914E probably benign Het
Mettl9 T A 7: 120,675,531 (GRCm39) D310E possibly damaging Het
Myh13 T G 11: 67,255,325 (GRCm39) V1565G probably benign Het
Nrf1 A G 6: 30,090,019 (GRCm39) T33A probably damaging Het
Oas1d A G 5: 121,054,947 (GRCm39) K173R probably benign Het
Or12e10 A T 2: 87,640,199 (GRCm39) M12L probably benign Het
Or1e34 T A 11: 73,778,530 (GRCm39) T223S probably benign Het
Or4k6 A G 14: 50,475,974 (GRCm39) Y123H probably damaging Het
Or8g54 A T 9: 39,707,342 (GRCm39) S224C probably damaging Het
Pde6a T A 18: 61,419,067 (GRCm39) D814E probably benign Het
Pilrb2 T C 5: 137,869,429 (GRCm39) D57G possibly damaging Het
Psg21 T A 7: 18,388,865 (GRCm39) T76S probably benign Het
Ralgapa1 A G 12: 55,754,808 (GRCm39) V1161A probably damaging Het
Rtl1 C G 12: 109,556,604 (GRCm39) *1745S probably null Het
Samd8 T C 14: 21,833,769 (GRCm39) C296R Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,957,756 (GRCm39) probably benign Het
Sfmbt1 T C 14: 30,506,697 (GRCm39) I247T possibly damaging Het
Smarca4 G A 9: 21,547,155 (GRCm39) A227T unknown Het
Trmt6 G A 2: 132,650,774 (GRCm39) S278L probably benign Het
Trpm6 T C 19: 18,815,462 (GRCm39) S1183P possibly damaging Het
Wnt10a C A 1: 74,842,728 (GRCm39) F401L possibly damaging Het
Zfp970 A T 2: 177,167,064 (GRCm39) K213* probably null Het
Other mutations in Trpm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Trpm7 APN 2 126,670,951 (GRCm39) missense possibly damaging 0.82
IGL01084:Trpm7 APN 2 126,687,992 (GRCm39) critical splice donor site probably null
IGL01634:Trpm7 APN 2 126,668,738 (GRCm39) missense probably damaging 1.00
IGL01678:Trpm7 APN 2 126,658,719 (GRCm39) missense probably damaging 0.99
IGL02005:Trpm7 APN 2 126,655,104 (GRCm39) missense probably damaging 0.97
IGL02064:Trpm7 APN 2 126,639,863 (GRCm39) missense probably damaging 1.00
IGL02156:Trpm7 APN 2 126,641,163 (GRCm39) unclassified probably benign
IGL02172:Trpm7 APN 2 126,637,248 (GRCm39) missense possibly damaging 0.94
IGL02334:Trpm7 APN 2 126,649,282 (GRCm39) missense probably benign
IGL02375:Trpm7 APN 2 126,667,664 (GRCm39) missense probably damaging 1.00
IGL02388:Trpm7 APN 2 126,661,811 (GRCm39) missense possibly damaging 0.80
IGL02552:Trpm7 APN 2 126,682,699 (GRCm39) missense probably damaging 1.00
IGL02684:Trpm7 APN 2 126,688,079 (GRCm39) missense probably damaging 0.99
IGL02901:Trpm7 APN 2 126,649,207 (GRCm39) critical splice donor site probably null
Accused UTSW 2 126,668,657 (GRCm39) missense probably damaging 0.99
Condemned UTSW 2 126,677,428 (GRCm39) missense probably damaging 1.00
denounced UTSW 2 126,654,941 (GRCm39) missense probably benign 0.00
deposed UTSW 2 126,639,418 (GRCm39) missense probably benign 0.01
Summac UTSW 2 126,661,883 (GRCm39) missense probably damaging 1.00
Vacated UTSW 2 126,691,842 (GRCm39) missense probably damaging 1.00
P0037:Trpm7 UTSW 2 126,658,677 (GRCm39) splice site probably benign
R0038:Trpm7 UTSW 2 126,637,388 (GRCm39) missense probably damaging 1.00
R0139:Trpm7 UTSW 2 126,654,691 (GRCm39) missense probably benign
R0165:Trpm7 UTSW 2 126,639,433 (GRCm39) missense probably damaging 0.97
R0511:Trpm7 UTSW 2 126,668,638 (GRCm39) nonsense probably null
R0543:Trpm7 UTSW 2 126,690,449 (GRCm39) missense probably damaging 1.00
R0784:Trpm7 UTSW 2 126,687,992 (GRCm39) critical splice donor site probably null
R0844:Trpm7 UTSW 2 126,677,428 (GRCm39) missense probably damaging 1.00
R0865:Trpm7 UTSW 2 126,641,159 (GRCm39) splice site probably null
R0919:Trpm7 UTSW 2 126,673,158 (GRCm39) missense probably damaging 1.00
R0972:Trpm7 UTSW 2 126,646,969 (GRCm39) missense probably benign
R1109:Trpm7 UTSW 2 126,639,713 (GRCm39) missense probably benign 0.01
R1118:Trpm7 UTSW 2 126,664,406 (GRCm39) missense possibly damaging 0.63
R1278:Trpm7 UTSW 2 126,667,374 (GRCm39) nonsense probably null
R1527:Trpm7 UTSW 2 126,672,082 (GRCm39) missense probably benign 0.18
R1542:Trpm7 UTSW 2 126,664,519 (GRCm39) nonsense probably null
R1882:Trpm7 UTSW 2 126,654,697 (GRCm39) missense probably benign 0.00
R1951:Trpm7 UTSW 2 126,673,219 (GRCm39) missense probably damaging 1.00
R2011:Trpm7 UTSW 2 126,665,917 (GRCm39) nonsense probably null
R2012:Trpm7 UTSW 2 126,665,917 (GRCm39) nonsense probably null
R2026:Trpm7 UTSW 2 126,654,658 (GRCm39) missense probably benign 0.39
R2067:Trpm7 UTSW 2 126,639,647 (GRCm39) missense probably damaging 1.00
R2926:Trpm7 UTSW 2 126,700,329 (GRCm39) splice site probably benign
R3082:Trpm7 UTSW 2 126,686,342 (GRCm39) missense possibly damaging 0.90
R3552:Trpm7 UTSW 2 126,668,630 (GRCm39) splice site probably benign
R3607:Trpm7 UTSW 2 126,638,348 (GRCm39) intron probably benign
R3739:Trpm7 UTSW 2 126,693,441 (GRCm39) missense probably damaging 1.00
R3943:Trpm7 UTSW 2 126,673,138 (GRCm39) missense possibly damaging 0.94
R4161:Trpm7 UTSW 2 126,658,751 (GRCm39) missense probably damaging 1.00
R4176:Trpm7 UTSW 2 126,671,083 (GRCm39) missense possibly damaging 0.83
R4392:Trpm7 UTSW 2 126,690,458 (GRCm39) missense probably damaging 1.00
R4392:Trpm7 UTSW 2 126,637,429 (GRCm39) splice site probably null
R4404:Trpm7 UTSW 2 126,675,635 (GRCm39) missense probably damaging 0.97
R4574:Trpm7 UTSW 2 126,639,131 (GRCm39) missense probably benign 0.01
R4714:Trpm7 UTSW 2 126,682,703 (GRCm39) nonsense probably null
R4807:Trpm7 UTSW 2 126,673,149 (GRCm39) missense probably benign 0.00
R4815:Trpm7 UTSW 2 126,700,412 (GRCm39) missense probably damaging 1.00
R4846:Trpm7 UTSW 2 126,655,105 (GRCm39) missense possibly damaging 0.63
R4972:Trpm7 UTSW 2 126,665,978 (GRCm39) missense probably damaging 1.00
R5097:Trpm7 UTSW 2 126,638,256 (GRCm39) critical splice donor site probably null
R5263:Trpm7 UTSW 2 126,663,137 (GRCm39) missense probably benign 0.34
R5361:Trpm7 UTSW 2 126,671,161 (GRCm39) missense possibly damaging 0.77
R5377:Trpm7 UTSW 2 126,684,775 (GRCm39) critical splice donor site probably null
R5574:Trpm7 UTSW 2 126,654,950 (GRCm39) missense probably benign
R5782:Trpm7 UTSW 2 126,639,634 (GRCm39) missense probably benign 0.04
R5840:Trpm7 UTSW 2 126,664,531 (GRCm39) nonsense probably null
R6044:Trpm7 UTSW 2 126,656,665 (GRCm39) missense probably damaging 1.00
R6178:Trpm7 UTSW 2 126,679,301 (GRCm39) missense probably damaging 1.00
R6196:Trpm7 UTSW 2 126,667,559 (GRCm39) missense possibly damaging 0.66
R6457:Trpm7 UTSW 2 126,649,214 (GRCm39) missense probably benign
R6530:Trpm7 UTSW 2 126,654,631 (GRCm39) missense probably damaging 1.00
R6764:Trpm7 UTSW 2 126,686,340 (GRCm39) missense possibly damaging 0.79
R6841:Trpm7 UTSW 2 126,654,941 (GRCm39) missense probably benign 0.00
R6868:Trpm7 UTSW 2 126,679,334 (GRCm39) missense probably damaging 1.00
R7250:Trpm7 UTSW 2 126,668,685 (GRCm39) missense possibly damaging 0.87
R7402:Trpm7 UTSW 2 126,641,126 (GRCm39) missense probably damaging 1.00
R7451:Trpm7 UTSW 2 126,668,657 (GRCm39) missense probably damaging 0.99
R7486:Trpm7 UTSW 2 126,673,115 (GRCm39) critical splice donor site probably null
R7509:Trpm7 UTSW 2 126,691,842 (GRCm39) missense probably damaging 1.00
R7586:Trpm7 UTSW 2 126,652,085 (GRCm39) missense probably benign
R7774:Trpm7 UTSW 2 126,655,158 (GRCm39) missense probably benign 0.09
R7793:Trpm7 UTSW 2 126,665,995 (GRCm39) nonsense probably null
R7812:Trpm7 UTSW 2 126,641,236 (GRCm39) missense probably damaging 1.00
R7900:Trpm7 UTSW 2 126,639,418 (GRCm39) missense probably benign 0.01
R7951:Trpm7 UTSW 2 126,655,188 (GRCm39) missense possibly damaging 0.94
R7965:Trpm7 UTSW 2 126,667,614 (GRCm39) missense probably damaging 0.99
R7992:Trpm7 UTSW 2 126,667,454 (GRCm39) missense probably benign
R8034:Trpm7 UTSW 2 126,688,119 (GRCm39) missense probably damaging 0.98
R8199:Trpm7 UTSW 2 126,691,918 (GRCm39) missense probably damaging 1.00
R8304:Trpm7 UTSW 2 126,639,797 (GRCm39) missense probably damaging 1.00
R8405:Trpm7 UTSW 2 126,658,755 (GRCm39) missense probably benign 0.26
R8674:Trpm7 UTSW 2 126,641,086 (GRCm39) unclassified probably benign
R8742:Trpm7 UTSW 2 126,667,469 (GRCm39) missense probably damaging 1.00
R8754:Trpm7 UTSW 2 126,664,623 (GRCm39) missense probably damaging 1.00
R8842:Trpm7 UTSW 2 126,663,131 (GRCm39) missense probably benign 0.05
R8850:Trpm7 UTSW 2 126,652,100 (GRCm39) missense probably benign 0.00
R8881:Trpm7 UTSW 2 126,661,883 (GRCm39) missense probably damaging 1.00
R8898:Trpm7 UTSW 2 126,664,661 (GRCm39) missense possibly damaging 0.92
R9339:Trpm7 UTSW 2 126,665,906 (GRCm39) missense probably benign 0.04
R9428:Trpm7 UTSW 2 126,671,140 (GRCm39) missense probably damaging 1.00
R9568:Trpm7 UTSW 2 126,664,510 (GRCm39) missense probably benign 0.02
R9647:Trpm7 UTSW 2 126,667,562 (GRCm39) missense probably damaging 1.00
R9678:Trpm7 UTSW 2 126,686,290 (GRCm39) missense probably damaging 1.00
R9746:Trpm7 UTSW 2 126,664,578 (GRCm39) missense possibly damaging 0.47
X0026:Trpm7 UTSW 2 126,671,210 (GRCm39) missense probably benign
Z1088:Trpm7 UTSW 2 126,639,201 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTATAACTGGACAACATTGATAG -3'
(R):5'- CATATGTAATCATTGGCCTTGGTGG -3'

Sequencing Primer
(F):5'- TCTATAGAGTTCTAGGACACCCAGG -3'
(R):5'- CTTGGTGGCAGAAGCAAGTTC -3'
Posted On 2022-06-15