Incidental Mutation 'R9446:Adgrf3'
ID 713935
Institutional Source Beutler Lab
Gene Symbol Adgrf3
Ensembl Gene ENSMUSG00000067642
Gene Name adhesion G protein-coupled receptor F3
Synonyms PGR23, LOC381628, Gpr113
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9446 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 30398429-30410720 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 30401957 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 690 (D690E)
Ref Sequence ENSEMBL: ENSMUSP00000085440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088117] [ENSMUST00000125367]
AlphaFold Q58Y75
Predicted Effect probably benign
Transcript: ENSMUST00000088117
AA Change: D690E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642
AA Change: D690E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
Blast:IG 163 252 2e-20 BLAST
Blast:CCP 341 399 1e-6 BLAST
low complexity region 403 415 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
GPS 632 684 2.68e-17 SMART
Pfam:7tm_2 687 935 1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125367
SMART Domains Protein: ENSMUSP00000120958
Gene: ENSMUSG00000067642

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T G 2: 120,976,530 (GRCm39) I90S probably null Het
Adck2 G T 6: 39,551,221 (GRCm39) probably benign Het
Aff3 C T 1: 38,574,337 (GRCm39) G175S probably benign Het
Atf7 T C 15: 102,459,923 (GRCm39) H159R probably damaging Het
BB014433 GGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGGGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGGGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,091,810 (GRCm39) probably benign Het
Birc6 A G 17: 74,925,491 (GRCm39) K2241R probably damaging Het
Cacna1s A G 1: 136,045,362 (GRCm39) E1670G probably benign Het
Clca4b C T 3: 144,638,134 (GRCm39) A43T probably benign Het
Clock T A 5: 76,396,288 (GRCm39) I154L probably benign Het
Dnah10 A T 5: 124,823,677 (GRCm39) D566V probably damaging Het
Eml1 T C 12: 108,481,465 (GRCm39) W443R probably damaging Het
Ghitm A G 14: 36,853,606 (GRCm39) I78T possibly damaging Het
Gm4181 A T 14: 51,873,062 (GRCm39) M1K probably null Het
Gm9195 T C 14: 72,717,957 (GRCm39) Y187C probably damaging Het
Htt A G 5: 34,919,272 (GRCm39) M8V probably benign Het
Ighv1-9 T C 12: 114,547,388 (GRCm39) Y51C probably benign Het
Kif13b G A 14: 64,984,470 (GRCm39) E636K probably damaging Het
Mamdc4 T A 2: 25,453,645 (GRCm39) M1179L probably benign Het
Map3k4 G A 17: 12,451,375 (GRCm39) A1506V probably damaging Het
Mbtd1 T C 11: 93,834,508 (GRCm39) S622P unknown Het
Med13l T A 5: 118,876,567 (GRCm39) D914E probably benign Het
Mettl9 T A 7: 120,675,531 (GRCm39) D310E possibly damaging Het
Myh13 T G 11: 67,255,325 (GRCm39) V1565G probably benign Het
Nrf1 A G 6: 30,090,019 (GRCm39) T33A probably damaging Het
Oas1d A G 5: 121,054,947 (GRCm39) K173R probably benign Het
Or12e10 A T 2: 87,640,199 (GRCm39) M12L probably benign Het
Or1e34 T A 11: 73,778,530 (GRCm39) T223S probably benign Het
Or4k6 A G 14: 50,475,974 (GRCm39) Y123H probably damaging Het
Or8g54 A T 9: 39,707,342 (GRCm39) S224C probably damaging Het
Pde6a T A 18: 61,419,067 (GRCm39) D814E probably benign Het
Pilrb2 T C 5: 137,869,429 (GRCm39) D57G possibly damaging Het
Psg21 T A 7: 18,388,865 (GRCm39) T76S probably benign Het
Ralgapa1 A G 12: 55,754,808 (GRCm39) V1161A probably damaging Het
Rtl1 C G 12: 109,556,604 (GRCm39) *1745S probably null Het
Samd8 T C 14: 21,833,769 (GRCm39) C296R Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,957,756 (GRCm39) probably benign Het
Sfmbt1 T C 14: 30,506,697 (GRCm39) I247T possibly damaging Het
Smarca4 G A 9: 21,547,155 (GRCm39) A227T unknown Het
Trmt6 G A 2: 132,650,774 (GRCm39) S278L probably benign Het
Trpm6 T C 19: 18,815,462 (GRCm39) S1183P possibly damaging Het
Trpm7 T A 2: 126,672,185 (GRCm39) probably null Het
Wnt10a C A 1: 74,842,728 (GRCm39) F401L possibly damaging Het
Zfp970 A T 2: 177,167,064 (GRCm39) K213* probably null Het
Other mutations in Adgrf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03080:Adgrf3 APN 5 30,401,827 (GRCm39) missense probably benign 0.02
IGL03171:Adgrf3 APN 5 30,401,292 (GRCm39) missense probably damaging 1.00
R0010:Adgrf3 UTSW 5 30,410,607 (GRCm39) splice site probably benign
R0042:Adgrf3 UTSW 5 30,402,426 (GRCm39) missense probably damaging 1.00
R0140:Adgrf3 UTSW 5 30,401,379 (GRCm39) missense probably benign 0.19
R0617:Adgrf3 UTSW 5 30,400,078 (GRCm39) missense probably benign 0.25
R0748:Adgrf3 UTSW 5 30,401,874 (GRCm39) missense probably damaging 1.00
R1291:Adgrf3 UTSW 5 30,404,532 (GRCm39) missense probably damaging 0.99
R1330:Adgrf3 UTSW 5 30,400,093 (GRCm39) missense probably benign 0.24
R1468:Adgrf3 UTSW 5 30,407,227 (GRCm39) splice site probably benign
R1695:Adgrf3 UTSW 5 30,408,553 (GRCm39) missense probably benign 0.05
R1716:Adgrf3 UTSW 5 30,402,549 (GRCm39) missense probably benign 0.03
R1844:Adgrf3 UTSW 5 30,404,211 (GRCm39) missense probably damaging 0.96
R1935:Adgrf3 UTSW 5 30,407,304 (GRCm39) missense probably benign 0.00
R1936:Adgrf3 UTSW 5 30,407,304 (GRCm39) missense probably benign 0.00
R2059:Adgrf3 UTSW 5 30,404,489 (GRCm39) missense possibly damaging 0.91
R2656:Adgrf3 UTSW 5 30,401,436 (GRCm39) missense possibly damaging 0.96
R2913:Adgrf3 UTSW 5 30,401,992 (GRCm39) missense probably damaging 1.00
R2914:Adgrf3 UTSW 5 30,401,992 (GRCm39) missense probably damaging 1.00
R2987:Adgrf3 UTSW 5 30,402,358 (GRCm39) missense probably damaging 1.00
R3797:Adgrf3 UTSW 5 30,401,821 (GRCm39) missense possibly damaging 0.49
R3798:Adgrf3 UTSW 5 30,401,821 (GRCm39) missense possibly damaging 0.49
R3799:Adgrf3 UTSW 5 30,401,821 (GRCm39) missense possibly damaging 0.49
R3934:Adgrf3 UTSW 5 30,405,432 (GRCm39) unclassified probably benign
R4043:Adgrf3 UTSW 5 30,409,360 (GRCm39) missense probably benign 0.00
R4080:Adgrf3 UTSW 5 30,402,367 (GRCm39) nonsense probably null
R4575:Adgrf3 UTSW 5 30,407,255 (GRCm39) missense probably benign 0.00
R4754:Adgrf3 UTSW 5 30,402,615 (GRCm39) critical splice acceptor site probably null
R4819:Adgrf3 UTSW 5 30,403,442 (GRCm39) missense possibly damaging 0.66
R4893:Adgrf3 UTSW 5 30,405,476 (GRCm39) missense probably benign 0.00
R4991:Adgrf3 UTSW 5 30,404,146 (GRCm39) missense probably benign 0.26
R5686:Adgrf3 UTSW 5 30,402,304 (GRCm39) missense probably damaging 1.00
R5965:Adgrf3 UTSW 5 30,410,637 (GRCm39) missense probably benign 0.00
R5997:Adgrf3 UTSW 5 30,403,360 (GRCm39) critical splice donor site probably null
R6103:Adgrf3 UTSW 5 30,401,265 (GRCm39) missense probably damaging 1.00
R6244:Adgrf3 UTSW 5 30,402,531 (GRCm39) missense probably benign 0.17
R6409:Adgrf3 UTSW 5 30,402,312 (GRCm39) missense probably damaging 0.96
R6575:Adgrf3 UTSW 5 30,401,522 (GRCm39) missense possibly damaging 0.72
R6745:Adgrf3 UTSW 5 30,408,601 (GRCm39) missense probably benign 0.31
R6790:Adgrf3 UTSW 5 30,401,385 (GRCm39) missense probably benign 0.00
R6813:Adgrf3 UTSW 5 30,402,519 (GRCm39) missense probably damaging 0.96
R7202:Adgrf3 UTSW 5 30,409,378 (GRCm39) nonsense probably null
R7250:Adgrf3 UTSW 5 30,400,680 (GRCm39) missense probably damaging 1.00
R7353:Adgrf3 UTSW 5 30,403,495 (GRCm39) missense probably damaging 0.98
R7634:Adgrf3 UTSW 5 30,407,245 (GRCm39) missense probably benign 0.01
R7658:Adgrf3 UTSW 5 30,402,204 (GRCm39) missense probably benign 0.41
R8037:Adgrf3 UTSW 5 30,404,510 (GRCm39) missense probably damaging 1.00
R8281:Adgrf3 UTSW 5 30,402,301 (GRCm39) missense possibly damaging 0.46
R8717:Adgrf3 UTSW 5 30,403,579 (GRCm39) unclassified probably benign
R8857:Adgrf3 UTSW 5 30,402,065 (GRCm39) nonsense probably null
R8926:Adgrf3 UTSW 5 30,405,446 (GRCm39) missense possibly damaging 0.46
R9391:Adgrf3 UTSW 5 30,400,071 (GRCm39) missense possibly damaging 0.94
R9522:Adgrf3 UTSW 5 30,404,482 (GRCm39) missense possibly damaging 0.90
Z1088:Adgrf3 UTSW 5 30,404,118 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGTGACTAGGCAGATCAGGC -3'
(R):5'- TGGAACCCTTCACTGTGTGTTC -3'

Sequencing Primer
(F):5'- CTAGGCAGATCAGGCTGTGG -3'
(R):5'- CACTGTGTGTTCTGGGACCAC -3'
Posted On 2022-06-15