Incidental Mutation 'R9446:Htt'
ID 713936
Institutional Source Beutler Lab
Gene Symbol Htt
Ensembl Gene ENSMUSG00000029104
Gene Name huntingtin
Synonyms Hdh, huntingtin, HD, IT15, htt, C430023I11Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9446 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 34919084-35069878 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34919272 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 8 (M8V)
Ref Sequence ENSEMBL: ENSMUSP00000078945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080036]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000080036
AA Change: M8V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078945
Gene: ENSMUSG00000029104
AA Change: M8V

DomainStartEndE-ValueType
low complexity region 18 65 N/A INTRINSIC
SCOP:d1qgra_ 92 370 1e-12 SMART
low complexity region 371 388 N/A INTRINSIC
low complexity region 432 453 N/A INTRINSIC
low complexity region 1150 1161 N/A INTRINSIC
low complexity region 1423 1441 N/A INTRINSIC
Pfam:DUF3652 1494 1534 9.3e-20 PFAM
low complexity region 1812 1822 N/A INTRINSIC
Blast:GAF 1866 2040 1e-104 BLAST
low complexity region 2461 2472 N/A INTRINSIC
low complexity region 2611 2621 N/A INTRINSIC
low complexity region 2622 2635 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants gastrulate abnormally and die in utero. Conditional mutants are small with progressive neurodegeneration. Knock-ins of 20-150 CAG repeat units variably mimic Huntington's with late-onset motor defects, reactive gliosis and neuronal inclusions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T G 2: 120,976,530 (GRCm39) I90S probably null Het
Adck2 G T 6: 39,551,221 (GRCm39) probably benign Het
Adgrf3 G T 5: 30,401,957 (GRCm39) D690E probably benign Het
Aff3 C T 1: 38,574,337 (GRCm39) G175S probably benign Het
Atf7 T C 15: 102,459,923 (GRCm39) H159R probably damaging Het
BB014433 GGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGGGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGGGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,091,810 (GRCm39) probably benign Het
Birc6 A G 17: 74,925,491 (GRCm39) K2241R probably damaging Het
Cacna1s A G 1: 136,045,362 (GRCm39) E1670G probably benign Het
Clca4b C T 3: 144,638,134 (GRCm39) A43T probably benign Het
Clock T A 5: 76,396,288 (GRCm39) I154L probably benign Het
Dnah10 A T 5: 124,823,677 (GRCm39) D566V probably damaging Het
Eml1 T C 12: 108,481,465 (GRCm39) W443R probably damaging Het
Ghitm A G 14: 36,853,606 (GRCm39) I78T possibly damaging Het
Gm4181 A T 14: 51,873,062 (GRCm39) M1K probably null Het
Gm9195 T C 14: 72,717,957 (GRCm39) Y187C probably damaging Het
Ighv1-9 T C 12: 114,547,388 (GRCm39) Y51C probably benign Het
Kif13b G A 14: 64,984,470 (GRCm39) E636K probably damaging Het
Mamdc4 T A 2: 25,453,645 (GRCm39) M1179L probably benign Het
Map3k4 G A 17: 12,451,375 (GRCm39) A1506V probably damaging Het
Mbtd1 T C 11: 93,834,508 (GRCm39) S622P unknown Het
Med13l T A 5: 118,876,567 (GRCm39) D914E probably benign Het
Mettl9 T A 7: 120,675,531 (GRCm39) D310E possibly damaging Het
Myh13 T G 11: 67,255,325 (GRCm39) V1565G probably benign Het
Nrf1 A G 6: 30,090,019 (GRCm39) T33A probably damaging Het
Oas1d A G 5: 121,054,947 (GRCm39) K173R probably benign Het
Or12e10 A T 2: 87,640,199 (GRCm39) M12L probably benign Het
Or1e34 T A 11: 73,778,530 (GRCm39) T223S probably benign Het
Or4k6 A G 14: 50,475,974 (GRCm39) Y123H probably damaging Het
Or8g54 A T 9: 39,707,342 (GRCm39) S224C probably damaging Het
Pde6a T A 18: 61,419,067 (GRCm39) D814E probably benign Het
Pilrb2 T C 5: 137,869,429 (GRCm39) D57G possibly damaging Het
Psg21 T A 7: 18,388,865 (GRCm39) T76S probably benign Het
Ralgapa1 A G 12: 55,754,808 (GRCm39) V1161A probably damaging Het
Rtl1 C G 12: 109,556,604 (GRCm39) *1745S probably null Het
Samd8 T C 14: 21,833,769 (GRCm39) C296R Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,957,756 (GRCm39) probably benign Het
Sfmbt1 T C 14: 30,506,697 (GRCm39) I247T possibly damaging Het
Smarca4 G A 9: 21,547,155 (GRCm39) A227T unknown Het
Trmt6 G A 2: 132,650,774 (GRCm39) S278L probably benign Het
Trpm6 T C 19: 18,815,462 (GRCm39) S1183P possibly damaging Het
Trpm7 T A 2: 126,672,185 (GRCm39) probably null Het
Wnt10a C A 1: 74,842,728 (GRCm39) F401L possibly damaging Het
Zfp970 A T 2: 177,167,064 (GRCm39) K213* probably null Het
Other mutations in Htt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Htt APN 5 34,956,752 (GRCm39) missense probably benign 0.00
IGL00233:Htt APN 5 35,053,370 (GRCm39) splice site probably null
IGL00559:Htt APN 5 35,006,448 (GRCm39) splice site probably benign
IGL00765:Htt APN 5 35,034,769 (GRCm39) splice site probably benign
IGL00950:Htt APN 5 35,048,785 (GRCm39) missense probably benign
IGL00953:Htt APN 5 34,976,021 (GRCm39) missense probably benign 0.04
IGL00957:Htt APN 5 34,964,068 (GRCm39) missense probably benign
IGL01314:Htt APN 5 35,036,200 (GRCm39) missense probably benign
IGL01412:Htt APN 5 35,055,916 (GRCm39) missense probably damaging 0.98
IGL01510:Htt APN 5 35,064,856 (GRCm39) missense probably damaging 1.00
IGL01617:Htt APN 5 35,034,099 (GRCm39) missense possibly damaging 0.67
IGL01893:Htt APN 5 35,034,174 (GRCm39) missense probably damaging 1.00
IGL01914:Htt APN 5 34,987,053 (GRCm39) missense probably benign
IGL01994:Htt APN 5 34,989,948 (GRCm39) missense possibly damaging 0.83
IGL02102:Htt APN 5 35,048,825 (GRCm39) splice site probably benign
IGL02381:Htt APN 5 34,987,104 (GRCm39) missense probably benign 0.03
IGL02529:Htt APN 5 34,976,387 (GRCm39) splice site probably benign
IGL02678:Htt APN 5 35,057,246 (GRCm39) missense probably damaging 1.00
IGL02707:Htt APN 5 34,987,225 (GRCm39) critical splice donor site probably null
IGL02731:Htt APN 5 34,961,137 (GRCm39) missense probably benign 0.41
IGL02931:Htt APN 5 35,034,097 (GRCm39) missense probably damaging 1.00
IGL03167:Htt APN 5 34,976,330 (GRCm39) missense probably damaging 0.98
IGL03343:Htt APN 5 34,983,385 (GRCm39) missense probably benign
IGL03344:Htt APN 5 35,037,172 (GRCm39) missense probably benign 0.39
IGL03344:Htt APN 5 35,064,810 (GRCm39) missense probably benign 0.02
IGL03366:Htt APN 5 35,064,924 (GRCm39) missense probably damaging 1.00
IGL03410:Htt APN 5 34,956,789 (GRCm39) missense probably damaging 0.99
Chalk UTSW 5 35,064,430 (GRCm39) missense possibly damaging 0.86
IGL02796:Htt UTSW 5 35,034,826 (GRCm39) missense probably benign 0.43
PIT4377001:Htt UTSW 5 35,033,309 (GRCm39) missense probably benign 0.10
R0013:Htt UTSW 5 34,977,448 (GRCm39) missense probably benign 0.25
R0049:Htt UTSW 5 35,066,006 (GRCm39) missense probably damaging 0.97
R0049:Htt UTSW 5 35,066,006 (GRCm39) missense probably damaging 0.97
R0056:Htt UTSW 5 34,983,422 (GRCm39) splice site probably benign
R0207:Htt UTSW 5 35,054,252 (GRCm39) missense probably benign 0.11
R0329:Htt UTSW 5 34,974,478 (GRCm39) splice site probably benign
R0494:Htt UTSW 5 34,979,188 (GRCm39) missense possibly damaging 0.73
R0548:Htt UTSW 5 35,028,090 (GRCm39) missense probably damaging 1.00
R0601:Htt UTSW 5 35,003,347 (GRCm39) missense probably benign 0.08
R0799:Htt UTSW 5 34,975,097 (GRCm39) missense probably benign 0.00
R0947:Htt UTSW 5 35,056,268 (GRCm39) missense probably damaging 1.00
R1053:Htt UTSW 5 35,008,561 (GRCm39) critical splice acceptor site probably null
R1147:Htt UTSW 5 35,008,596 (GRCm39) missense probably damaging 0.98
R1147:Htt UTSW 5 35,008,596 (GRCm39) missense probably damaging 0.98
R1478:Htt UTSW 5 34,961,171 (GRCm39) missense probably damaging 0.99
R1573:Htt UTSW 5 35,021,718 (GRCm39) splice site probably benign
R1677:Htt UTSW 5 34,985,918 (GRCm39) missense probably damaging 1.00
R1792:Htt UTSW 5 35,064,543 (GRCm39) missense probably damaging 1.00
R1816:Htt UTSW 5 34,961,084 (GRCm39) missense probably benign 0.01
R1833:Htt UTSW 5 35,063,092 (GRCm39) splice site probably benign
R1837:Htt UTSW 5 34,976,367 (GRCm39) missense probably benign 0.00
R1846:Htt UTSW 5 35,006,288 (GRCm39) missense probably damaging 0.98
R1875:Htt UTSW 5 34,951,456 (GRCm39) missense probably benign 0.05
R1899:Htt UTSW 5 35,064,429 (GRCm39) missense probably benign 0.01
R2013:Htt UTSW 5 35,010,215 (GRCm39) missense probably damaging 0.99
R2062:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2064:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2067:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2068:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2131:Htt UTSW 5 35,034,453 (GRCm39) missense possibly damaging 0.50
R2162:Htt UTSW 5 34,979,062 (GRCm39) missense probably benign 0.44
R2169:Htt UTSW 5 35,034,819 (GRCm39) missense probably benign 0.08
R2345:Htt UTSW 5 34,983,348 (GRCm39) missense possibly damaging 0.80
R2433:Htt UTSW 5 35,064,885 (GRCm39) missense possibly damaging 0.65
R3027:Htt UTSW 5 34,977,439 (GRCm39) missense possibly damaging 0.85
R3123:Htt UTSW 5 34,961,875 (GRCm39) missense probably benign
R3125:Htt UTSW 5 34,961,875 (GRCm39) missense probably benign
R3717:Htt UTSW 5 34,968,866 (GRCm39) splice site probably benign
R3758:Htt UTSW 5 35,053,314 (GRCm39) missense probably damaging 0.97
R3805:Htt UTSW 5 35,034,548 (GRCm39) splice site probably null
R3833:Htt UTSW 5 34,979,062 (GRCm39) missense probably benign 0.44
R4066:Htt UTSW 5 35,036,191 (GRCm39) missense probably benign
R4272:Htt UTSW 5 35,006,413 (GRCm39) missense possibly damaging 0.96
R4625:Htt UTSW 5 34,987,129 (GRCm39) missense probably damaging 0.99
R4634:Htt UTSW 5 35,033,292 (GRCm39) missense probably benign 0.06
R4655:Htt UTSW 5 35,063,476 (GRCm39) missense probably benign 0.06
R4679:Htt UTSW 5 34,977,424 (GRCm39) missense probably benign
R4684:Htt UTSW 5 35,010,109 (GRCm39) missense probably damaging 1.00
R4832:Htt UTSW 5 34,982,184 (GRCm39) missense probably benign 0.01
R4833:Htt UTSW 5 35,009,569 (GRCm39) missense probably damaging 0.98
R4973:Htt UTSW 5 34,970,367 (GRCm39) missense probably damaging 0.99
R5095:Htt UTSW 5 34,981,739 (GRCm39) missense possibly damaging 0.89
R5132:Htt UTSW 5 35,063,023 (GRCm39) missense possibly damaging 0.89
R5351:Htt UTSW 5 34,961,177 (GRCm39) missense probably damaging 0.99
R5361:Htt UTSW 5 35,064,928 (GRCm39) missense possibly damaging 0.47
R5399:Htt UTSW 5 35,034,495 (GRCm39) missense probably damaging 0.98
R5462:Htt UTSW 5 35,042,851 (GRCm39) nonsense probably null
R5552:Htt UTSW 5 34,979,118 (GRCm39) missense probably benign
R5566:Htt UTSW 5 35,006,419 (GRCm39) missense probably damaging 1.00
R5595:Htt UTSW 5 35,062,741 (GRCm39) missense probably damaging 0.96
R5617:Htt UTSW 5 35,028,150 (GRCm39) missense possibly damaging 0.77
R5835:Htt UTSW 5 34,970,534 (GRCm39) missense probably benign 0.16
R5891:Htt UTSW 5 35,028,167 (GRCm39) missense possibly damaging 0.62
R6158:Htt UTSW 5 35,064,430 (GRCm39) missense possibly damaging 0.86
R6159:Htt UTSW 5 34,962,020 (GRCm39) missense probably benign 0.08
R6169:Htt UTSW 5 35,064,817 (GRCm39) missense probably damaging 1.00
R6242:Htt UTSW 5 35,003,356 (GRCm39) missense probably damaging 1.00
R6274:Htt UTSW 5 35,009,431 (GRCm39) missense possibly damaging 0.81
R6280:Htt UTSW 5 35,028,103 (GRCm39) missense probably benign 0.00
R6294:Htt UTSW 5 34,979,170 (GRCm39) missense probably benign
R6331:Htt UTSW 5 35,053,231 (GRCm39) missense possibly damaging 0.89
R6448:Htt UTSW 5 35,033,336 (GRCm39) missense probably benign 0.05
R6474:Htt UTSW 5 34,982,239 (GRCm39) missense probably benign 0.06
R6592:Htt UTSW 5 35,034,388 (GRCm39) missense possibly damaging 0.92
R6818:Htt UTSW 5 34,940,111 (GRCm39) missense probably damaging 0.99
R6830:Htt UTSW 5 34,991,670 (GRCm39) missense possibly damaging 0.82
R6920:Htt UTSW 5 35,034,444 (GRCm39) missense probably null 1.00
R6962:Htt UTSW 5 35,057,115 (GRCm39) critical splice acceptor site probably null
R7057:Htt UTSW 5 34,979,067 (GRCm39) missense probably null 0.05
R7144:Htt UTSW 5 35,003,350 (GRCm39) missense probably damaging 1.00
R7166:Htt UTSW 5 35,010,238 (GRCm39) missense probably benign 0.42
R7329:Htt UTSW 5 34,987,099 (GRCm39) missense probably benign 0.03
R7378:Htt UTSW 5 34,961,143 (GRCm39) missense probably benign 0.04
R7418:Htt UTSW 5 34,947,697 (GRCm39) missense possibly damaging 0.55
R7495:Htt UTSW 5 34,968,821 (GRCm39) missense probably benign 0.00
R7554:Htt UTSW 5 35,022,084 (GRCm39) missense probably damaging 0.97
R7575:Htt UTSW 5 35,062,987 (GRCm39) missense probably damaging 1.00
R7763:Htt UTSW 5 35,009,534 (GRCm39) missense probably damaging 1.00
R7782:Htt UTSW 5 35,040,336 (GRCm39) missense probably benign 0.03
R7850:Htt UTSW 5 35,009,631 (GRCm39) splice site probably null
R7870:Htt UTSW 5 35,055,891 (GRCm39) missense possibly damaging 0.77
R7871:Htt UTSW 5 35,021,993 (GRCm39) missense probably benign 0.00
R7879:Htt UTSW 5 34,981,252 (GRCm39) missense probably benign
R7992:Htt UTSW 5 34,987,225 (GRCm39) critical splice donor site probably null
R8058:Htt UTSW 5 34,977,444 (GRCm39) missense probably benign
R8168:Htt UTSW 5 35,040,300 (GRCm39) missense probably benign 0.00
R8188:Htt UTSW 5 34,919,287 (GRCm39) missense probably benign 0.03
R8262:Htt UTSW 5 35,053,304 (GRCm39) missense probably benign
R8343:Htt UTSW 5 35,063,068 (GRCm39) missense probably damaging 1.00
R8353:Htt UTSW 5 35,034,499 (GRCm39) missense possibly damaging 0.49
R8769:Htt UTSW 5 34,977,633 (GRCm39) missense probably benign 0.05
R8808:Htt UTSW 5 35,046,791 (GRCm39) missense probably benign 0.10
R8825:Htt UTSW 5 34,983,304 (GRCm39) missense probably benign 0.24
R8843:Htt UTSW 5 35,046,809 (GRCm39) missense possibly damaging 0.92
R8856:Htt UTSW 5 35,060,675 (GRCm39) missense probably benign 0.44
R8882:Htt UTSW 5 34,979,061 (GRCm39) missense probably benign
R8898:Htt UTSW 5 34,976,376 (GRCm39) missense probably benign 0.01
R8964:Htt UTSW 5 35,062,720 (GRCm39) missense probably benign 0.09
R8987:Htt UTSW 5 34,977,368 (GRCm39) missense probably benign 0.18
R8991:Htt UTSW 5 35,063,062 (GRCm39) missense probably damaging 1.00
R9005:Htt UTSW 5 34,975,095 (GRCm39) missense possibly damaging 0.92
R9019:Htt UTSW 5 35,023,920 (GRCm39) missense probably damaging 1.00
R9057:Htt UTSW 5 35,009,454 (GRCm39) missense possibly damaging 0.86
R9157:Htt UTSW 5 34,987,171 (GRCm39) missense probably null 0.89
R9205:Htt UTSW 5 34,976,367 (GRCm39) missense probably benign 0.00
R9223:Htt UTSW 5 35,062,692 (GRCm39) missense probably benign 0.01
R9243:Htt UTSW 5 35,056,276 (GRCm39) splice site probably benign
R9329:Htt UTSW 5 34,989,957 (GRCm39) missense possibly damaging 0.69
R9355:Htt UTSW 5 35,053,247 (GRCm39) missense probably benign
R9402:Htt UTSW 5 35,006,324 (GRCm39) missense probably damaging 1.00
R9716:Htt UTSW 5 35,012,019 (GRCm39) missense probably damaging 1.00
Z1177:Htt UTSW 5 35,009,575 (GRCm39) missense probably null 0.87
Predicted Primers PCR Primer
(F):5'- CTGTCAATTCTGCGGGTCTG -3'
(R):5'- AGGGAACAGTGTTGGCCATG -3'

Sequencing Primer
(F):5'- GCATGACGTCACGGGAC -3'
(R):5'- ACTCACGGTCGGTGCAG -3'
Posted On 2022-06-15