Incidental Mutation 'R9446:Med13l'
ID 713939
Institutional Source Beutler Lab
Gene Symbol Med13l
Ensembl Gene ENSMUSG00000018076
Gene Name mediator complex subunit 13-like
Synonyms 9030618F05Rik, Thrap2, 6330591G05Rik, 2210413I17Rik, Trap240L
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock # R9446 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 118560679-118765438 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118738502 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 914 (D914E)
Ref Sequence ENSEMBL: ENSMUSP00000098379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100816] [ENSMUST00000201010]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000100816
AA Change: D914E

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000098379
Gene: ENSMUSG00000018076
AA Change: D914E

DomainStartEndE-ValueType
Pfam:Med13_N 1 380 2.5e-116 PFAM
low complexity region 442 460 N/A INTRINSIC
low complexity region 542 558 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1541 1593 N/A INTRINSIC
low complexity region 1601 1611 N/A INTRINSIC
Pfam:Med13_C 1675 2197 1e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201010
AA Change: D914E

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144092
Gene: ENSMUSG00000018076
AA Change: D914E

DomainStartEndE-ValueType
Pfam:Med13_N 1 380 1e-112 PFAM
low complexity region 442 460 N/A INTRINSIC
low complexity region 542 558 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1541 1593 N/A INTRINSIC
low complexity region 1601 1611 N/A INTRINSIC
Pfam:Med13_C 1675 2206 1.7e-138 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the Mediator complex, a large complex of proteins that functions as a transcriptional coactivator for most RNA polymerase II-transcribed genes. The encoded protein is involved in early development of the heart and brain. Defects in this gene are a cause of transposition of the great arteries, dextro-looped (DTGA).[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T G 2: 121,146,049 I90S probably null Het
Adck2 G T 6: 39,574,287 probably benign Het
Adgrf3 G T 5: 30,196,959 D690E probably benign Het
Aff3 C T 1: 38,535,256 G175S probably benign Het
Atf7 T C 15: 102,551,488 H159R probably damaging Het
BB014433 GGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGGGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGGGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,041,810 probably benign Het
Birc6 A G 17: 74,618,496 K2241R probably damaging Het
Cacna1s A G 1: 136,117,624 E1670G probably benign Het
Clca4b C T 3: 144,932,373 A43T probably benign Het
Clock T A 5: 76,248,441 I154L probably benign Het
Dnah10 A T 5: 124,746,613 D566V probably damaging Het
Eml1 T C 12: 108,515,206 W443R probably damaging Het
Ghitm A G 14: 37,131,649 I78T possibly damaging Het
Gm4181 A T 14: 51,635,605 M1K probably null Het
Gm9195 T C 14: 72,480,517 Y187C probably damaging Het
Htt A G 5: 34,761,928 M8V probably benign Het
Ighv1-9 T C 12: 114,583,768 Y51C probably benign Het
Kif13b G A 14: 64,747,021 E636K probably damaging Het
Mamdc4 T A 2: 25,563,633 M1179L probably benign Het
Map3k4 G A 17: 12,232,488 A1506V probably damaging Het
Mbtd1 T C 11: 93,943,682 S622P unknown Het
Mettl9 T A 7: 121,076,308 D310E possibly damaging Het
Myh13 T G 11: 67,364,499 V1565G probably benign Het
Nrf1 A G 6: 30,090,020 T33A probably damaging Het
Oas1d A G 5: 120,916,884 K173R probably benign Het
Olfr1145 A T 2: 87,809,855 M12L probably benign Het
Olfr394 T A 11: 73,887,704 T223S probably benign Het
Olfr731 A G 14: 50,238,517 Y123H probably damaging Het
Olfr969 A T 9: 39,796,046 S224C probably damaging Het
Pde6a T A 18: 61,285,996 D814E probably benign Het
Pilrb2 T C 5: 137,871,167 D57G possibly damaging Het
Psg21 T A 7: 18,654,940 T76S probably benign Het
Ralgapa1 A G 12: 55,708,023 V1161A probably damaging Het
Rtl1 C G 12: 109,590,170 *1745S probably null Het
Samd8 T C 14: 21,783,701 C296R Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sfmbt1 T C 14: 30,784,740 I247T possibly damaging Het
Smarca4 G A 9: 21,635,859 A227T unknown Het
Trmt6 G A 2: 132,808,854 S278L probably benign Het
Trpm6 T C 19: 18,838,098 S1183P possibly damaging Het
Trpm7 T A 2: 126,830,265 probably null Het
Wnt10a C A 1: 74,803,569 F401L possibly damaging Het
Zfp970 A T 2: 177,475,271 K213* probably null Het
Other mutations in Med13l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Med13l APN 5 118724071 missense probably damaging 0.99
IGL01012:Med13l APN 5 118734028 missense probably damaging 0.99
IGL01316:Med13l APN 5 118762781 missense probably damaging 1.00
IGL01529:Med13l APN 5 118742335 missense probably damaging 1.00
IGL01731:Med13l APN 5 118742407 missense probably benign 0.05
IGL01790:Med13l APN 5 118593522 missense probably damaging 1.00
IGL02394:Med13l APN 5 118748833 missense probably benign 0.37
IGL02432:Med13l APN 5 118738400 missense possibly damaging 0.90
IGL02698:Med13l APN 5 118762829 missense probably damaging 0.99
IGL02801:Med13l APN 5 118745113 missense probably damaging 1.00
IGL03242:Med13l APN 5 118747445 missense probably benign
IGL03270:Med13l APN 5 118731430 missense probably damaging 1.00
Basics UTSW 5 118759264 critical splice donor site probably null
firmament UTSW 5 118745006 splice site probably null
Fundament UTSW 5 118721474 missense probably damaging 1.00
Root UTSW 5 118593445 missense probably damaging 1.00
P0035:Med13l UTSW 5 118742620 missense probably benign 0.00
R0051:Med13l UTSW 5 118742655 missense probably damaging 1.00
R0051:Med13l UTSW 5 118742655 missense probably damaging 1.00
R0136:Med13l UTSW 5 118724050 missense probably benign 0.15
R0158:Med13l UTSW 5 118742449 missense unknown
R0197:Med13l UTSW 5 118671002 splice site probably benign
R0370:Med13l UTSW 5 118741826 missense probably benign 0.14
R0492:Med13l UTSW 5 118738495 missense probably damaging 1.00
R0532:Med13l UTSW 5 118759123 missense possibly damaging 0.78
R0726:Med13l UTSW 5 118748684 missense probably damaging 0.99
R0738:Med13l UTSW 5 118751633 missense probably damaging 0.99
R0827:Med13l UTSW 5 118726247 splice site probably benign
R0883:Med13l UTSW 5 118671002 splice site probably benign
R0959:Med13l UTSW 5 118754285 missense possibly damaging 0.89
R1458:Med13l UTSW 5 118738459 missense probably benign 0.00
R1562:Med13l UTSW 5 118738519 missense probably damaging 1.00
R1577:Med13l UTSW 5 118721392 missense probably damaging 1.00
R1661:Med13l UTSW 5 118749748 missense probably damaging 1.00
R1665:Med13l UTSW 5 118749748 missense probably damaging 1.00
R1720:Med13l UTSW 5 118741995 missense probably damaging 1.00
R1929:Med13l UTSW 5 118728833 missense probably benign 0.01
R1967:Med13l UTSW 5 118761322 missense probably damaging 0.99
R2301:Med13l UTSW 5 118593447 missense probably damaging 1.00
R3691:Med13l UTSW 5 118721497 missense probably benign 0.16
R3895:Med13l UTSW 5 118761323 missense probably null 0.99
R4043:Med13l UTSW 5 118593463 missense probably damaging 1.00
R4593:Med13l UTSW 5 118742560 missense probably damaging 1.00
R4902:Med13l UTSW 5 118745130 missense probably damaging 1.00
R4995:Med13l UTSW 5 118730949 missense possibly damaging 0.90
R5010:Med13l UTSW 5 118593550 missense possibly damaging 0.95
R5057:Med13l UTSW 5 118718493 missense probably damaging 1.00
R5369:Med13l UTSW 5 118724010 missense probably benign 0.02
R5446:Med13l UTSW 5 118742397 missense possibly damaging 0.81
R5564:Med13l UTSW 5 118742040 missense probably damaging 1.00
R5566:Med13l UTSW 5 118728665 missense possibly damaging 0.95
R5580:Med13l UTSW 5 118751630 missense possibly damaging 0.95
R5634:Med13l UTSW 5 118560850 missense possibly damaging 0.88
R5748:Med13l UTSW 5 118593445 missense probably damaging 1.00
R5764:Med13l UTSW 5 118728642 missense probably damaging 0.99
R5765:Med13l UTSW 5 118728642 missense probably damaging 0.99
R6083:Med13l UTSW 5 118721486 missense possibly damaging 0.80
R6504:Med13l UTSW 5 118754321 missense probably benign 0.34
R6546:Med13l UTSW 5 118721474 missense probably damaging 1.00
R6797:Med13l UTSW 5 118759264 critical splice donor site probably null
R6911:Med13l UTSW 5 118755658 missense possibly damaging 0.95
R6942:Med13l UTSW 5 118745006 splice site probably null
R7018:Med13l UTSW 5 118751986 missense probably damaging 0.99
R7096:Med13l UTSW 5 118721926 missense possibly damaging 0.90
R7113:Med13l UTSW 5 118726265 missense probably benign 0.09
R7136:Med13l UTSW 5 118721522 missense possibly damaging 0.90
R7140:Med13l UTSW 5 118741972 missense probably benign 0.27
R7345:Med13l UTSW 5 118742760 missense probably damaging 1.00
R7409:Med13l UTSW 5 118754321 missense probably benign 0.34
R7410:Med13l UTSW 5 118560832 missense possibly damaging 0.94
R7432:Med13l UTSW 5 118751938 missense probably damaging 0.99
R7486:Med13l UTSW 5 118728474 missense probably benign 0.17
R7509:Med13l UTSW 5 118748930 missense probably damaging 0.97
R7722:Med13l UTSW 5 118747407 missense probably benign 0.32
R7802:Med13l UTSW 5 118728590 missense probably benign 0.03
R8081:Med13l UTSW 5 118728268 missense probably damaging 1.00
R8260:Med13l UTSW 5 118748729 missense possibly damaging 0.95
R8266:Med13l UTSW 5 118742109 missense probably damaging 1.00
R8347:Med13l UTSW 5 118742597 missense probably benign
R8365:Med13l UTSW 5 118728644 missense possibly damaging 0.81
R8508:Med13l UTSW 5 118754321 missense probably benign 0.34
R8920:Med13l UTSW 5 118747478 nonsense probably null
R8970:Med13l UTSW 5 118745099 missense probably damaging 1.00
R8994:Med13l UTSW 5 118728161 missense possibly damaging 0.78
R9045:Med13l UTSW 5 118742751 missense probably benign
R9401:Med13l UTSW 5 118745024 missense probably benign 0.14
R9445:Med13l UTSW 5 118724149 missense probably benign 0.00
R9714:Med13l UTSW 5 118728373 missense probably benign 0.44
R9777:Med13l UTSW 5 118748959 missense probably benign
R9781:Med13l UTSW 5 118729967 missense possibly damaging 0.60
R9797:Med13l UTSW 5 118742079 missense probably damaging 1.00
X0065:Med13l UTSW 5 118729883 missense probably damaging 1.00
Z1088:Med13l UTSW 5 118749641 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTTGCAAAGGATGTTCCCC -3'
(R):5'- GTGCTTCATAAAACCCAGGC -3'

Sequencing Primer
(F):5'- AGGATGTTCCCCACCCC -3'
(R):5'- ACCGACTGTAATTCAATAGTTCTCTC -3'
Posted On 2022-06-15