Incidental Mutation 'R9446:Psg21'
ID 713945
Institutional Source Beutler Lab
Gene Symbol Psg21
Ensembl Gene ENSMUSG00000070796
Gene Name pregnancy-specific beta-1-glycoprotein 21
Synonyms 1600019C01Rik, 1600026N13Rik, 1600025N01Rik, cea8
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R9446 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 18380661-18390650 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18388865 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 76 (T76S)
Ref Sequence ENSEMBL: ENSMUSP00000092387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094793] [ENSMUST00000182128]
AlphaFold Q9DAV5
Predicted Effect probably benign
Transcript: ENSMUST00000094793
AA Change: T76S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092387
Gene: ENSMUSG00000070796
AA Change: T76S

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
IGc2 393 457 1.47e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182128
AA Change: T76S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000138173
Gene: ENSMUSG00000070796
AA Change: T76S

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T G 2: 120,976,530 (GRCm39) I90S probably null Het
Adck2 G T 6: 39,551,221 (GRCm39) probably benign Het
Adgrf3 G T 5: 30,401,957 (GRCm39) D690E probably benign Het
Aff3 C T 1: 38,574,337 (GRCm39) G175S probably benign Het
Atf7 T C 15: 102,459,923 (GRCm39) H159R probably damaging Het
BB014433 GGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGGGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGGGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,091,810 (GRCm39) probably benign Het
Birc6 A G 17: 74,925,491 (GRCm39) K2241R probably damaging Het
Cacna1s A G 1: 136,045,362 (GRCm39) E1670G probably benign Het
Clca4b C T 3: 144,638,134 (GRCm39) A43T probably benign Het
Clock T A 5: 76,396,288 (GRCm39) I154L probably benign Het
Dnah10 A T 5: 124,823,677 (GRCm39) D566V probably damaging Het
Eml1 T C 12: 108,481,465 (GRCm39) W443R probably damaging Het
Ghitm A G 14: 36,853,606 (GRCm39) I78T possibly damaging Het
Gm4181 A T 14: 51,873,062 (GRCm39) M1K probably null Het
Gm9195 T C 14: 72,717,957 (GRCm39) Y187C probably damaging Het
Htt A G 5: 34,919,272 (GRCm39) M8V probably benign Het
Ighv1-9 T C 12: 114,547,388 (GRCm39) Y51C probably benign Het
Kif13b G A 14: 64,984,470 (GRCm39) E636K probably damaging Het
Mamdc4 T A 2: 25,453,645 (GRCm39) M1179L probably benign Het
Map3k4 G A 17: 12,451,375 (GRCm39) A1506V probably damaging Het
Mbtd1 T C 11: 93,834,508 (GRCm39) S622P unknown Het
Med13l T A 5: 118,876,567 (GRCm39) D914E probably benign Het
Mettl9 T A 7: 120,675,531 (GRCm39) D310E possibly damaging Het
Myh13 T G 11: 67,255,325 (GRCm39) V1565G probably benign Het
Nrf1 A G 6: 30,090,019 (GRCm39) T33A probably damaging Het
Oas1d A G 5: 121,054,947 (GRCm39) K173R probably benign Het
Or12e10 A T 2: 87,640,199 (GRCm39) M12L probably benign Het
Or1e34 T A 11: 73,778,530 (GRCm39) T223S probably benign Het
Or4k6 A G 14: 50,475,974 (GRCm39) Y123H probably damaging Het
Or8g54 A T 9: 39,707,342 (GRCm39) S224C probably damaging Het
Pde6a T A 18: 61,419,067 (GRCm39) D814E probably benign Het
Pilrb2 T C 5: 137,869,429 (GRCm39) D57G possibly damaging Het
Ralgapa1 A G 12: 55,754,808 (GRCm39) V1161A probably damaging Het
Rtl1 C G 12: 109,556,604 (GRCm39) *1745S probably null Het
Samd8 T C 14: 21,833,769 (GRCm39) C296R Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,957,756 (GRCm39) probably benign Het
Sfmbt1 T C 14: 30,506,697 (GRCm39) I247T possibly damaging Het
Smarca4 G A 9: 21,547,155 (GRCm39) A227T unknown Het
Trmt6 G A 2: 132,650,774 (GRCm39) S278L probably benign Het
Trpm6 T C 19: 18,815,462 (GRCm39) S1183P possibly damaging Het
Trpm7 T A 2: 126,672,185 (GRCm39) probably null Het
Wnt10a C A 1: 74,842,728 (GRCm39) F401L possibly damaging Het
Zfp970 A T 2: 177,167,064 (GRCm39) K213* probably null Het
Other mutations in Psg21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Psg21 APN 7 18,388,750 (GRCm39) missense probably damaging 1.00
IGL02390:Psg21 APN 7 18,386,556 (GRCm39) missense probably benign 0.11
IGL02548:Psg21 APN 7 18,388,961 (GRCm39) missense possibly damaging 0.89
IGL03001:Psg21 APN 7 18,386,410 (GRCm39) missense probably benign 0.03
IGL03135:Psg21 APN 7 18,388,843 (GRCm39) missense probably benign 0.00
R0131:Psg21 UTSW 7 18,388,793 (GRCm39) missense probably benign 0.39
R0551:Psg21 UTSW 7 18,386,565 (GRCm39) critical splice acceptor site probably null
R1512:Psg21 UTSW 7 18,390,425 (GRCm39) missense probably benign 0.00
R1874:Psg21 UTSW 7 18,384,741 (GRCm39) missense probably benign 0.15
R1993:Psg21 UTSW 7 18,388,695 (GRCm39) missense probably benign 0.04
R2327:Psg21 UTSW 7 18,386,378 (GRCm39) missense possibly damaging 0.61
R3414:Psg21 UTSW 7 18,386,305 (GRCm39) missense probably damaging 1.00
R4422:Psg21 UTSW 7 18,381,257 (GRCm39) missense probably damaging 1.00
R5138:Psg21 UTSW 7 18,390,453 (GRCm39) start codon destroyed probably null 0.94
R5623:Psg21 UTSW 7 18,388,939 (GRCm39) missense probably damaging 1.00
R5686:Psg21 UTSW 7 18,386,183 (GRCm39) intron probably benign
R6166:Psg21 UTSW 7 18,390,664 (GRCm39) unclassified probably benign
R6177:Psg21 UTSW 7 18,386,279 (GRCm39) missense possibly damaging 0.64
R6190:Psg21 UTSW 7 18,388,926 (GRCm39) missense possibly damaging 0.61
R6210:Psg21 UTSW 7 18,386,270 (GRCm39) missense probably damaging 1.00
R6482:Psg21 UTSW 7 18,388,664 (GRCm39) splice site probably null
R6729:Psg21 UTSW 7 18,386,516 (GRCm39) missense probably damaging 1.00
R6866:Psg21 UTSW 7 18,386,209 (GRCm39) missense probably damaging 1.00
R6992:Psg21 UTSW 7 18,388,668 (GRCm39) critical splice donor site probably null
R7075:Psg21 UTSW 7 18,388,786 (GRCm39) missense probably damaging 1.00
R7081:Psg21 UTSW 7 18,388,774 (GRCm39) nonsense probably null
R7098:Psg21 UTSW 7 18,386,470 (GRCm39) missense probably damaging 1.00
R7582:Psg21 UTSW 7 18,381,128 (GRCm39) makesense probably null
R7588:Psg21 UTSW 7 18,381,134 (GRCm39) missense probably benign 0.00
R7607:Psg21 UTSW 7 18,388,708 (GRCm39) missense probably benign 0.02
R7830:Psg21 UTSW 7 18,381,223 (GRCm39) missense probably damaging 1.00
R7964:Psg21 UTSW 7 18,381,136 (GRCm39) missense probably benign 0.01
R8758:Psg21 UTSW 7 18,384,678 (GRCm39) missense probably damaging 1.00
R8972:Psg21 UTSW 7 18,381,293 (GRCm39) missense probably benign 0.03
R8988:Psg21 UTSW 7 18,386,389 (GRCm39) missense probably benign 0.00
R9119:Psg21 UTSW 7 18,381,409 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGGACGTATTTGATTCCAGTTCTC -3'
(R):5'- GCATAAGCTGAGGGATGCTC -3'

Sequencing Primer
(F):5'- ACGTATTTGATTCCAGTTCTCCATGG -3'
(R):5'- TAAGCTGAGGGATGCTCACACC -3'
Posted On 2022-06-15