Incidental Mutation 'R9446:Psg21'
ID 713945
Institutional Source Beutler Lab
Gene Symbol Psg21
Ensembl Gene ENSMUSG00000070796
Gene Name pregnancy-specific glycoprotein 21
Synonyms 1600026N13Rik, 1600019C01Rik, 1600025N01Rik, cea8
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock # R9446 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 18646736-18656725 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18654940 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 76 (T76S)
Ref Sequence ENSEMBL: ENSMUSP00000092387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094793] [ENSMUST00000182128]
AlphaFold Q9DAV5
Predicted Effect probably benign
Transcript: ENSMUST00000094793
AA Change: T76S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092387
Gene: ENSMUSG00000070796
AA Change: T76S

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
IGc2 393 457 1.47e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182128
AA Change: T76S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000138173
Gene: ENSMUSG00000070796
AA Change: T76S

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T G 2: 121,146,049 I90S probably null Het
Adck2 G T 6: 39,574,287 probably benign Het
Adgrf3 G T 5: 30,196,959 D690E probably benign Het
Aff3 C T 1: 38,535,256 G175S probably benign Het
Atf7 T C 15: 102,551,488 H159R probably damaging Het
BB014433 GGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGGGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGGGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,041,810 probably benign Het
Birc6 A G 17: 74,618,496 K2241R probably damaging Het
Cacna1s A G 1: 136,117,624 E1670G probably benign Het
Clca4b C T 3: 144,932,373 A43T probably benign Het
Clock T A 5: 76,248,441 I154L probably benign Het
Dnah10 A T 5: 124,746,613 D566V probably damaging Het
Eml1 T C 12: 108,515,206 W443R probably damaging Het
Ghitm A G 14: 37,131,649 I78T possibly damaging Het
Gm4181 A T 14: 51,635,605 M1K probably null Het
Gm9195 T C 14: 72,480,517 Y187C probably damaging Het
Htt A G 5: 34,761,928 M8V probably benign Het
Ighv1-9 T C 12: 114,583,768 Y51C probably benign Het
Kif13b G A 14: 64,747,021 E636K probably damaging Het
Mamdc4 T A 2: 25,563,633 M1179L probably benign Het
Map3k4 G A 17: 12,232,488 A1506V probably damaging Het
Mbtd1 T C 11: 93,943,682 S622P unknown Het
Med13l T A 5: 118,738,502 D914E probably benign Het
Mettl9 T A 7: 121,076,308 D310E possibly damaging Het
Myh13 T G 11: 67,364,499 V1565G probably benign Het
Nrf1 A G 6: 30,090,020 T33A probably damaging Het
Oas1d A G 5: 120,916,884 K173R probably benign Het
Olfr1145 A T 2: 87,809,855 M12L probably benign Het
Olfr394 T A 11: 73,887,704 T223S probably benign Het
Olfr731 A G 14: 50,238,517 Y123H probably damaging Het
Olfr969 A T 9: 39,796,046 S224C probably damaging Het
Pde6a T A 18: 61,285,996 D814E probably benign Het
Pilrb2 T C 5: 137,871,167 D57G possibly damaging Het
Ralgapa1 A G 12: 55,708,023 V1161A probably damaging Het
Rtl1 C G 12: 109,590,170 *1745S probably null Het
Samd8 T C 14: 21,783,701 C296R Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sfmbt1 T C 14: 30,784,740 I247T possibly damaging Het
Smarca4 G A 9: 21,635,859 A227T unknown Het
Trmt6 G A 2: 132,808,854 S278L probably benign Het
Trpm6 T C 19: 18,838,098 S1183P possibly damaging Het
Trpm7 T A 2: 126,830,265 probably null Het
Wnt10a C A 1: 74,803,569 F401L possibly damaging Het
Zfp970 A T 2: 177,475,271 K213* probably null Het
Other mutations in Psg21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Psg21 APN 7 18654825 missense probably damaging 1.00
IGL02390:Psg21 APN 7 18652631 missense probably benign 0.11
IGL02548:Psg21 APN 7 18655036 missense possibly damaging 0.89
IGL03001:Psg21 APN 7 18652485 missense probably benign 0.03
IGL03135:Psg21 APN 7 18654918 missense probably benign 0.00
R0131:Psg21 UTSW 7 18654868 missense probably benign 0.39
R0551:Psg21 UTSW 7 18652640 critical splice acceptor site probably null
R1512:Psg21 UTSW 7 18656500 missense probably benign 0.00
R1874:Psg21 UTSW 7 18650816 missense probably benign 0.15
R1993:Psg21 UTSW 7 18654770 missense probably benign 0.04
R2327:Psg21 UTSW 7 18652453 missense possibly damaging 0.61
R3414:Psg21 UTSW 7 18652380 missense probably damaging 1.00
R4422:Psg21 UTSW 7 18647332 missense probably damaging 1.00
R5138:Psg21 UTSW 7 18656528 start codon destroyed probably null 0.94
R5623:Psg21 UTSW 7 18655014 missense probably damaging 1.00
R5686:Psg21 UTSW 7 18652258 intron probably benign
R6166:Psg21 UTSW 7 18656739 unclassified probably benign
R6177:Psg21 UTSW 7 18652354 missense possibly damaging 0.64
R6190:Psg21 UTSW 7 18655001 missense possibly damaging 0.61
R6210:Psg21 UTSW 7 18652345 missense probably damaging 1.00
R6482:Psg21 UTSW 7 18654739 splice site probably null
R6729:Psg21 UTSW 7 18652591 missense probably damaging 1.00
R6866:Psg21 UTSW 7 18652284 missense probably damaging 1.00
R6992:Psg21 UTSW 7 18654743 critical splice donor site probably null
R7075:Psg21 UTSW 7 18654861 missense probably damaging 1.00
R7081:Psg21 UTSW 7 18654849 nonsense probably null
R7098:Psg21 UTSW 7 18652545 missense probably damaging 1.00
R7582:Psg21 UTSW 7 18647203 makesense probably null
R7588:Psg21 UTSW 7 18647209 missense probably benign 0.00
R7607:Psg21 UTSW 7 18654783 missense probably benign 0.02
R7830:Psg21 UTSW 7 18647298 missense probably damaging 1.00
R7964:Psg21 UTSW 7 18647211 missense probably benign 0.01
R8758:Psg21 UTSW 7 18650753 missense probably damaging 1.00
R8972:Psg21 UTSW 7 18647368 missense probably benign 0.03
R8988:Psg21 UTSW 7 18652464 missense probably benign 0.00
R9119:Psg21 UTSW 7 18647484 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGGACGTATTTGATTCCAGTTCTC -3'
(R):5'- GCATAAGCTGAGGGATGCTC -3'

Sequencing Primer
(F):5'- ACGTATTTGATTCCAGTTCTCCATGG -3'
(R):5'- TAAGCTGAGGGATGCTCACACC -3'
Posted On 2022-06-15