Incidental Mutation 'R9446:Smarca4'
ID 713948
Institutional Source Beutler Lab
Gene Symbol Smarca4
Ensembl Gene ENSMUSG00000032187
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Synonyms SW1/SNF, Brg1, SNF2beta, b2b692Clo, b2b508.1Clo
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9446 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 21527465-21615526 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 21547155 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 227 (A227T)
Ref Sequence ENSEMBL: ENSMUSP00000096547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034707] [ENSMUST00000098948] [ENSMUST00000174008]
AlphaFold Q3TKT4
Predicted Effect probably benign
Transcript: ENSMUST00000034707
AA Change: A227T

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034707
Gene: ENSMUSG00000032187
AA Change: A227T

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1360 1385 N/A INTRINSIC
low complexity region 1388 1398 N/A INTRINSIC
BROMO 1422 1533 4.19e-42 SMART
low complexity region 1534 1557 N/A INTRINSIC
low complexity region 1578 1588 N/A INTRINSIC
low complexity region 1594 1614 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000098948
AA Change: A227T
SMART Domains Protein: ENSMUSP00000096547
Gene: ENSMUSG00000032187
AA Change: A227T

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1363 1388 N/A INTRINSIC
low complexity region 1391 1401 N/A INTRINSIC
BROMO 1425 1536 4.19e-42 SMART
low complexity region 1537 1560 N/A INTRINSIC
low complexity region 1581 1591 N/A INTRINSIC
low complexity region 1597 1617 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000133535
Gene: ENSMUSG00000032187
AA Change: A31T

DomainStartEndE-ValueType
low complexity region 26 52 N/A INTRINSIC
low complexity region 57 94 N/A INTRINSIC
low complexity region 109 135 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
HSA 265 337 2e-27 SMART
coiled coil region 367 399 N/A INTRINSIC
BRK 417 461 5.17e-21 SMART
low complexity region 462 477 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
DEXDc 555 747 5.17e-38 SMART
Blast:DEXDc 758 790 6e-10 BLAST
low complexity region 824 839 N/A INTRINSIC
HELICc 915 999 7.27e-24 SMART
low complexity region 1088 1105 N/A INTRINSIC
SnAC 1126 1194 2.8e-29 SMART
low complexity region 1201 1226 N/A INTRINSIC
low complexity region 1229 1239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174008
AA Change: A227T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133922
Gene: ENSMUSG00000032187
AA Change: A227T

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1360 1385 N/A INTRINSIC
low complexity region 1388 1398 N/A INTRINSIC
BROMO 1422 1532 1.36e-41 SMART
low complexity region 1533 1556 N/A INTRINSIC
low complexity region 1577 1587 N/A INTRINSIC
low complexity region 1593 1613 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a null allele die in utero before implantation. Embryos heterozygous for this null allele and an ENU-induced allele show impaired definitive erythropoiesis, anemia and lethality during organogenesis. Heterozygotes for a different null allele show cyanosis and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T G 2: 120,976,530 (GRCm39) I90S probably null Het
Adck2 G T 6: 39,551,221 (GRCm39) probably benign Het
Adgrf3 G T 5: 30,401,957 (GRCm39) D690E probably benign Het
Aff3 C T 1: 38,574,337 (GRCm39) G175S probably benign Het
Atf7 T C 15: 102,459,923 (GRCm39) H159R probably damaging Het
BB014433 GGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGGGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGGGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,091,810 (GRCm39) probably benign Het
Birc6 A G 17: 74,925,491 (GRCm39) K2241R probably damaging Het
Cacna1s A G 1: 136,045,362 (GRCm39) E1670G probably benign Het
Clca4b C T 3: 144,638,134 (GRCm39) A43T probably benign Het
Clock T A 5: 76,396,288 (GRCm39) I154L probably benign Het
Dnah10 A T 5: 124,823,677 (GRCm39) D566V probably damaging Het
Eml1 T C 12: 108,481,465 (GRCm39) W443R probably damaging Het
Ghitm A G 14: 36,853,606 (GRCm39) I78T possibly damaging Het
Gm4181 A T 14: 51,873,062 (GRCm39) M1K probably null Het
Gm9195 T C 14: 72,717,957 (GRCm39) Y187C probably damaging Het
Htt A G 5: 34,919,272 (GRCm39) M8V probably benign Het
Ighv1-9 T C 12: 114,547,388 (GRCm39) Y51C probably benign Het
Kif13b G A 14: 64,984,470 (GRCm39) E636K probably damaging Het
Mamdc4 T A 2: 25,453,645 (GRCm39) M1179L probably benign Het
Map3k4 G A 17: 12,451,375 (GRCm39) A1506V probably damaging Het
Mbtd1 T C 11: 93,834,508 (GRCm39) S622P unknown Het
Med13l T A 5: 118,876,567 (GRCm39) D914E probably benign Het
Mettl9 T A 7: 120,675,531 (GRCm39) D310E possibly damaging Het
Myh13 T G 11: 67,255,325 (GRCm39) V1565G probably benign Het
Nrf1 A G 6: 30,090,019 (GRCm39) T33A probably damaging Het
Oas1d A G 5: 121,054,947 (GRCm39) K173R probably benign Het
Or12e10 A T 2: 87,640,199 (GRCm39) M12L probably benign Het
Or1e34 T A 11: 73,778,530 (GRCm39) T223S probably benign Het
Or4k6 A G 14: 50,475,974 (GRCm39) Y123H probably damaging Het
Or8g54 A T 9: 39,707,342 (GRCm39) S224C probably damaging Het
Pde6a T A 18: 61,419,067 (GRCm39) D814E probably benign Het
Pilrb2 T C 5: 137,869,429 (GRCm39) D57G possibly damaging Het
Psg21 T A 7: 18,388,865 (GRCm39) T76S probably benign Het
Ralgapa1 A G 12: 55,754,808 (GRCm39) V1161A probably damaging Het
Rtl1 C G 12: 109,556,604 (GRCm39) *1745S probably null Het
Samd8 T C 14: 21,833,769 (GRCm39) C296R Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,957,756 (GRCm39) probably benign Het
Sfmbt1 T C 14: 30,506,697 (GRCm39) I247T possibly damaging Het
Trmt6 G A 2: 132,650,774 (GRCm39) S278L probably benign Het
Trpm6 T C 19: 18,815,462 (GRCm39) S1183P possibly damaging Het
Trpm7 T A 2: 126,672,185 (GRCm39) probably null Het
Wnt10a C A 1: 74,842,728 (GRCm39) F401L possibly damaging Het
Zfp970 A T 2: 177,167,064 (GRCm39) K213* probably null Het
Other mutations in Smarca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Smarca4 APN 9 21,590,369 (GRCm39) missense probably benign 0.30
IGL01694:Smarca4 APN 9 21,577,166 (GRCm39) missense probably damaging 1.00
IGL02147:Smarca4 APN 9 21,546,999 (GRCm39) missense probably damaging 0.98
IGL02417:Smarca4 APN 9 21,612,386 (GRCm39) missense probably damaging 1.00
IGL02421:Smarca4 APN 9 21,550,535 (GRCm39) missense probably damaging 1.00
IGL02550:Smarca4 APN 9 21,597,418 (GRCm39) missense probably benign 0.25
IGL02794:Smarca4 APN 9 21,584,638 (GRCm39) splice site probably benign
IGL03030:Smarca4 APN 9 21,547,132 (GRCm39) missense probably benign 0.14
IGL03037:Smarca4 APN 9 21,544,231 (GRCm39) unclassified probably benign
IGL03069:Smarca4 APN 9 21,547,132 (GRCm39) missense probably benign 0.14
IGL03355:Smarca4 APN 9 21,547,132 (GRCm39) missense probably benign 0.14
R0123:Smarca4 UTSW 9 21,548,620 (GRCm39) missense probably damaging 1.00
R0134:Smarca4 UTSW 9 21,548,620 (GRCm39) missense probably damaging 1.00
R0230:Smarca4 UTSW 9 21,612,168 (GRCm39) missense probably damaging 0.99
R0269:Smarca4 UTSW 9 21,547,497 (GRCm39) missense probably benign 0.09
R0631:Smarca4 UTSW 9 21,570,280 (GRCm39) splice site probably benign
R0665:Smarca4 UTSW 9 21,612,239 (GRCm39) small deletion probably benign
R0726:Smarca4 UTSW 9 21,611,435 (GRCm39) critical splice donor site probably null
R0801:Smarca4 UTSW 9 21,553,850 (GRCm39) missense possibly damaging 0.81
R0918:Smarca4 UTSW 9 21,547,511 (GRCm39) missense probably benign 0.16
R1411:Smarca4 UTSW 9 21,570,251 (GRCm39) missense probably damaging 1.00
R1604:Smarca4 UTSW 9 21,612,239 (GRCm39) small deletion probably benign
R1768:Smarca4 UTSW 9 21,612,479 (GRCm39) missense possibly damaging 0.56
R2004:Smarca4 UTSW 9 21,588,776 (GRCm39) missense probably damaging 1.00
R2031:Smarca4 UTSW 9 21,597,358 (GRCm39) missense possibly damaging 0.68
R2211:Smarca4 UTSW 9 21,597,325 (GRCm39) missense probably damaging 1.00
R2512:Smarca4 UTSW 9 21,546,994 (GRCm39) missense possibly damaging 0.95
R2875:Smarca4 UTSW 9 21,553,876 (GRCm39) missense possibly damaging 0.55
R3786:Smarca4 UTSW 9 21,583,355 (GRCm39) missense possibly damaging 0.94
R4829:Smarca4 UTSW 9 21,550,623 (GRCm39) missense probably damaging 0.97
R5084:Smarca4 UTSW 9 21,572,059 (GRCm39) missense probably damaging 1.00
R5222:Smarca4 UTSW 9 21,567,002 (GRCm39) missense probably benign 0.01
R5785:Smarca4 UTSW 9 21,597,322 (GRCm39) missense probably damaging 0.99
R5844:Smarca4 UTSW 9 21,589,238 (GRCm39) intron probably benign
R5964:Smarca4 UTSW 9 21,558,726 (GRCm39) missense probably benign 0.00
R6001:Smarca4 UTSW 9 21,544,205 (GRCm39) unclassified probably benign
R6072:Smarca4 UTSW 9 21,611,417 (GRCm39) missense probably damaging 1.00
R6254:Smarca4 UTSW 9 21,611,173 (GRCm39) missense probably damaging 1.00
R6320:Smarca4 UTSW 9 21,548,671 (GRCm39) missense probably damaging 1.00
R6353:Smarca4 UTSW 9 21,590,445 (GRCm39) critical splice donor site probably null
R6461:Smarca4 UTSW 9 21,590,316 (GRCm39) missense probably damaging 1.00
R6886:Smarca4 UTSW 9 21,570,127 (GRCm39) missense probably damaging 1.00
R7098:Smarca4 UTSW 9 21,546,116 (GRCm39) missense probably benign 0.10
R7253:Smarca4 UTSW 9 21,570,256 (GRCm39) missense probably benign 0.01
R7307:Smarca4 UTSW 9 21,550,096 (GRCm39) missense probably damaging 1.00
R7382:Smarca4 UTSW 9 21,570,229 (GRCm39) missense probably damaging 0.98
R7445:Smarca4 UTSW 9 21,597,543 (GRCm39) missense probably damaging 1.00
R7535:Smarca4 UTSW 9 21,558,921 (GRCm39) missense possibly damaging 0.82
R7573:Smarca4 UTSW 9 21,550,371 (GRCm39) splice site probably null
R7644:Smarca4 UTSW 9 21,566,950 (GRCm39) missense probably benign 0.00
R7734:Smarca4 UTSW 9 21,578,658 (GRCm39) missense possibly damaging 0.65
R7833:Smarca4 UTSW 9 21,558,655 (GRCm39) missense possibly damaging 0.86
R8085:Smarca4 UTSW 9 21,570,108 (GRCm39) splice site probably null
R8119:Smarca4 UTSW 9 21,558,922 (GRCm39) missense possibly damaging 0.61
R8320:Smarca4 UTSW 9 21,588,798 (GRCm39) missense probably benign 0.10
R8445:Smarca4 UTSW 9 21,612,239 (GRCm39) small deletion probably benign
R8493:Smarca4 UTSW 9 21,570,144 (GRCm39) missense probably damaging 1.00
R8748:Smarca4 UTSW 9 21,546,164 (GRCm39) missense possibly damaging 0.85
R8788:Smarca4 UTSW 9 21,550,024 (GRCm39) missense probably damaging 1.00
R8817:Smarca4 UTSW 9 21,547,497 (GRCm39) missense probably benign 0.04
R9241:Smarca4 UTSW 9 21,550,604 (GRCm39) missense possibly damaging 0.72
R9570:Smarca4 UTSW 9 21,580,849 (GRCm39) missense probably damaging 1.00
R9727:Smarca4 UTSW 9 21,611,160 (GRCm39) missense probably damaging 1.00
R9801:Smarca4 UTSW 9 21,586,397 (GRCm39) missense probably damaging 1.00
Z1176:Smarca4 UTSW 9 21,614,253 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGATGGTTCTGATCCCCAGGC -3'
(R):5'- ACTACCACAGCAGTCCTAGG -3'

Sequencing Primer
(F):5'- CAGGCCTTGGGACAGCAAAAC -3'
(R):5'- CTAGGGACCACTAGCTAGGAGTC -3'
Posted On 2022-06-15