Mutagenetix > Incidental Mutation

Incidental Mutation 'R9447:Cadps2'

713988

Institutional Source

Beutler Lab

Gene Symbol

Cadps2

Ensembl Gene

ENSMUSG00000017978

Gene Name

Ca2+-dependent activator protein for secretion 2

Synonyms

Caps2, cpd2, A230044C21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9447 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

23262773-23839421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 23323298 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 1007 (I1007K)

Ref Sequence

ENSEMBL: ENSMUSP00000111018 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018122
AA Change: I1057K

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: I1057K

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: I1050K

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	895	5.54e-51	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115358
AA Change: I1017K

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: I1017K

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115361
AA Change: I1007K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: I1007K

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	892	1.9e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125350
AA Change: I652K

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: I652K

Domain	Start	End	E-Value	Type
C2	14	112	1.51e-1	SMART
PH	137	241	2.94e-11	SMART
DUF1041	446	537	1.9e-49	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000142913
AA Change: I1028K

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: I1028K

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	22	39	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.14e-52	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163871
AA Change: I1057K

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: I1057K

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	7.2e-50	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166458
AA Change: I1028K

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: I1028K

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.05e-51	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago4	G	A	4: 126,508,358	P572S	probably benign	Het
Akr1c19	A	G	13: 4,246,839	I295V	probably benign	Het
Ccdc144b	A	G	3: 36,020,046	V318A	possibly damaging	Het
Cd47	C	A	16: 49,895,459	T196K		Het
Cdrt4	T	G	11: 62,992,592	L40R	probably damaging	Het
Cox16	A	T	12: 81,359,335	C72S	probably benign	Het
Cyp2t4	G	A	7: 27,155,292	V66M	possibly damaging	Het
Daxx	A	T	17: 33,913,273	D497V	unknown	Het
Ddt	A	G	10: 75,772,837	V62A	possibly damaging	Het
Dhx57	A	G	17: 80,242,094	V1294A	probably damaging	Het
Dnaaf5	A	G	5: 139,177,988	T667A	probably damaging	Het
Dnase2a	A	C	8: 84,909,157	S90R	probably damaging	Het
Dytn	A	G	1: 63,661,143	V276A		Het
Efcab8	G	C	2: 153,804,941	V397L	unknown	Het
Enpp6	A	T	8: 47,030,565	R131W	probably damaging	Het
Epm2a	C	T	10: 11,448,688	H174Y	possibly damaging	Het
Fam160a2	G	T	7: 105,384,948	T492K	probably benign	Het
Fcho1	A	G	8: 71,717,269	L70P	probably damaging	Het
Fstl4	G	T	11: 53,186,339	C641F	probably damaging	Het
Ganab	C	T	19: 8,909,530	H327Y	probably damaging	Het
Gkn1	A	G	6: 87,346,340	Y164H	probably benign	Het
Gm10037	A	G	13: 67,833,834	E55G	probably damaging	Het
Gm5538	T	A	3: 59,743,630	Y58N	probably damaging	Het
Hpf1	A	G	8: 60,895,584	D111G	probably damaging	Het
Hs3st2	C	T	7: 121,393,066	R113W	probably damaging	Het
Ighm	A	T	12: 113,421,174	L353Q		Het
Ksr1	T	C	11: 79,018,333	D782G	unknown	Het
Lpin2	A	G	17: 71,232,092	K392E	unknown	Het
Lrrc4	A	G	6: 28,830,651	S322P	probably benign	Het
Man2a1	T	C	17: 64,659,006	V313A	possibly damaging	Het
Mctp1	A	G	13: 76,579,785	S9G	probably benign	Het
Morn5	A	T	2: 36,079,513		probably null	Het
Mroh2b	C	T	15: 4,931,341	A795V	probably damaging	Het
Ncf4	G	T	15: 78,262,299	A310S	probably benign	Het
Nedd4	T	C	9: 72,670,099	Y69H	probably benign	Het
Nras	T	C	3: 103,060,357	F90L	possibly damaging	Het
Nrxn3	T	C	12: 89,254,908	F113L	probably benign	Het
Ntsr1	C	T	2: 180,538,747	T282I	probably benign	Het
Olfr396-ps1	G	T	11: 73,928,791	C189F	probably benign	Het
Osbpl3	T	A	6: 50,344,877	K310*	probably null	Het
Pcca	T	C	14: 122,616,878	V194A	probably damaging	Het
Plekha5	A	G	6: 140,579,466	Y900C	probably damaging	Het
Prss22	T	C	17: 23,993,863	D300G	probably benign	Het
Rad17	A	T	13: 100,627,611	Y451N	probably damaging	Het
Rnf181	G	T	6: 72,360,587	T97K	probably damaging	Het
Sec24d	T	C	3: 123,290,513	S114P	probably benign	Het
Siae	C	A	9: 37,646,447	Q517K	probably benign	Het
Smurf2	A	T	11: 106,824,722	V653D	probably damaging	Het
Sqor	C	A	2: 122,807,600	T359K	possibly damaging	Het
Taf6	A	T	5: 138,178,708	*637R	probably null	Het
Tas2r109	A	C	6: 132,980,307	M220R	probably damaging	Het
Tlr2	T	A	3: 83,841,138		probably null	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Tmem8b	T	G	4: 43,685,766	L179R	probably damaging	Het
Tnfrsf10b	T	A	14: 69,776,159	H179Q	probably damaging	Het
Trip11	T	A	12: 101,883,889	K1305N	probably damaging	Het
Ttn	C	A	2: 76,752,518	W22677L	probably damaging	Het
Ube2r2	T	C	4: 41,190,655	V183A	probably damaging	Het
Ubqln4	T	A	3: 88,556,817	D208E	probably benign	Het
Ugt2a3	T	A	5: 87,325,471	N529I	probably benign	Het
Vmn1r125	A	G	7: 21,272,702	N175S	probably benign	Het
Xirp2	T	A	2: 67,508,606	I397K	probably damaging	Het
Zfp821	G	A	8: 109,724,184	V270I	probably damaging	Het
Zfp935	A	G	13: 62,455,028	V99A	possibly damaging	Het

Other mutations in Cadps2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Cadps2	APN	6	23496874	missense	possibly damaging	0.84
IGL01105:Cadps2	APN	6	23321700	splice site	probably benign
IGL01317:Cadps2	APN	6	23314173	missense	possibly damaging	0.76
IGL01409:Cadps2	APN	6	23587441	missense	probably damaging	1.00
IGL01477:Cadps2	APN	6	23263673	missense	probably damaging	1.00
IGL01620:Cadps2	APN	6	23587462	missense	probably benign	0.19
IGL01674:Cadps2	APN	6	23355852	missense	probably damaging	1.00
IGL01675:Cadps2	APN	6	23382905	missense	probably damaging	1.00
IGL01895:Cadps2	APN	6	23427275	missense	probably damaging	0.98
IGL02095:Cadps2	APN	6	23427310	missense	probably benign	0.01
IGL02200:Cadps2	APN	6	23385528	missense	probably damaging	1.00
IGL02380:Cadps2	APN	6	23287732	missense	probably benign	0.11
IGL02680:Cadps2	APN	6	23838896	missense	probably damaging	0.99
IGL02814:Cadps2	APN	6	23321707	missense	probably damaging	1.00
IGL02940:Cadps2	APN	6	23496809	missense	probably benign	0.08
IGL03061:Cadps2	APN	6	23287660	splice site	probably null
IGL03233:Cadps2	APN	6	23263601	missense	probably benign	0.10
R0193:Cadps2	UTSW	6	23599440	missense	probably benign	0.00
R0389:Cadps2	UTSW	6	23321782	missense	possibly damaging	0.88
R0571:Cadps2	UTSW	6	23583412	missense	probably damaging	1.00
R0595:Cadps2	UTSW	6	23321704	critical splice donor site	probably null
R0620:Cadps2	UTSW	6	23583396	missense	probably damaging	1.00
R0723:Cadps2	UTSW	6	23287698	missense	probably damaging	0.99
R0831:Cadps2	UTSW	6	23321740	missense	possibly damaging	0.88
R0836:Cadps2	UTSW	6	23328776	splice site	probably benign
R0942:Cadps2	UTSW	6	23263562	missense	probably damaging	1.00
R1099:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R1120:Cadps2	UTSW	6	23838794	missense	probably damaging	1.00
R1216:Cadps2	UTSW	6	23583473	splice site	probably benign
R1575:Cadps2	UTSW	6	23429218	missense	probably damaging	1.00
R1780:Cadps2	UTSW	6	23320932	critical splice donor site	probably null
R1924:Cadps2	UTSW	6	23688858	missense	probably damaging	0.99
R1944:Cadps2	UTSW	6	23599480	missense	probably damaging	0.99
R1956:Cadps2	UTSW	6	23287686	missense	probably damaging	1.00
R1986:Cadps2	UTSW	6	23323380	missense	probably damaging	1.00
R2045:Cadps2	UTSW	6	23839122	missense	possibly damaging	0.73
R2146:Cadps2	UTSW	6	23838999	intron	probably benign
R2147:Cadps2	UTSW	6	23838999	intron	probably benign
R2148:Cadps2	UTSW	6	23838999	intron	probably benign
R2150:Cadps2	UTSW	6	23838999	intron	probably benign
R2219:Cadps2	UTSW	6	23410832	missense	probably damaging	1.00
R2264:Cadps2	UTSW	6	23323340	missense	probably benign	0.15
R2338:Cadps2	UTSW	6	23838978	splice site	probably benign
R3861:Cadps2	UTSW	6	23355861	missense	probably damaging	1.00
R3898:Cadps2	UTSW	6	23528126	missense	probably damaging	1.00
R3982:Cadps2	UTSW	6	23263531	utr 3 prime	probably benign
R4213:Cadps2	UTSW	6	23599463	missense	probably damaging	1.00
R4384:Cadps2	UTSW	6	23412988	missense	probably benign	0.18
R4432:Cadps2	UTSW	6	23626738	missense	probably damaging	0.99
R4609:Cadps2	UTSW	6	23587579	missense	probably damaging	1.00
R4806:Cadps2	UTSW	6	23688860	missense	probably damaging	0.96
R4977:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R5174:Cadps2	UTSW	6	23287743	missense	probably damaging	1.00
R5267:Cadps2	UTSW	6	23626668	missense	possibly damaging	0.79
R5389:Cadps2	UTSW	6	23329104	missense	probably damaging	1.00
R5737:Cadps2	UTSW	6	23328805	missense	probably benign	0.28
R6074:Cadps2	UTSW	6	23626671	missense	probably damaging	1.00
R6254:Cadps2	UTSW	6	23329163	critical splice acceptor site	probably null
R6323:Cadps2	UTSW	6	23263578	missense	probably benign	0.04
R6463:Cadps2	UTSW	6	23323334	nonsense	probably null
R6907:Cadps2	UTSW	6	23599506	missense	probably damaging	1.00
R6940:Cadps2	UTSW	6	23302492	missense	probably damaging	1.00
R6964:Cadps2	UTSW	6	23583459	missense	probably damaging	1.00
R7079:Cadps2	UTSW	6	23323409	missense	probably damaging	1.00
R7139:Cadps2	UTSW	6	23410889	missense	probably damaging	1.00
R7156:Cadps2	UTSW	6	23688956	missense	probably benign	0.02
R7184:Cadps2	UTSW	6	23583429	missense	probably benign	0.18
R7325:Cadps2	UTSW	6	23409935	missense	unknown
R7526:Cadps2	UTSW	6	23496851	missense	probably damaging	1.00
R7546:Cadps2	UTSW	6	23626608	missense	probably benign	0.15
R7772:Cadps2	UTSW	6	23390446	missense	probably benign	0.00
R7870:Cadps2	UTSW	6	23263642	missense	probably benign	0.14
R8040:Cadps2	UTSW	6	23412943	splice site	probably benign
R8048:Cadps2	UTSW	6	23838863	missense	probably benign	0.14
R8082:Cadps2	UTSW	6	23323314	missense	probably damaging	1.00
R8100:Cadps2	UTSW	6	23838809	missense	probably damaging	1.00
R8115:Cadps2	UTSW	6	23328898	missense	probably benign	0.00
R8497:Cadps2	UTSW	6	23355919	missense	probably benign	0.27
R8768:Cadps2	UTSW	6	23382939	missense	probably damaging	1.00
R8783:Cadps2	UTSW	6	23302304	missense	possibly damaging	0.57
R8804:Cadps2	UTSW	6	23496806	missense	probably damaging	1.00
R8832:Cadps2	UTSW	6	23587537	missense	possibly damaging	0.52
R8848:Cadps2	UTSW	6	23344257	missense	probably damaging	1.00
R8854:Cadps2	UTSW	6	23385508	missense	probably damaging	1.00
R8896:Cadps2	UTSW	6	23410877	missense	probably damaging	1.00
R8910:Cadps2	UTSW	6	23344224	missense	probably benign	0.11
R8921:Cadps2	UTSW	6	23302301	missense	probably benign	0.00
R9228:Cadps2	UTSW	6	23688928	missense	probably benign	0.00
R9297:Cadps2	UTSW	6	23496888	missense	probably benign
R9318:Cadps2	UTSW	6	23496888	missense	probably benign
R9348:Cadps2	UTSW	6	23344263	missense	probably benign	0.20
R9484:Cadps2	UTSW	6	23626647	missense	probably benign	0.02
R9492:Cadps2	UTSW	6	23427239	missense	probably benign
R9630:Cadps2	UTSW	6	23587572	missense	probably benign	0.08
R9729:Cadps2	UTSW	6	23382983	missense	probably benign	0.28
Z1176:Cadps2	UTSW	6	23321801	missense	probably benign	0.24
Z1177:Cadps2	UTSW	6	23385478	missense	possibly damaging	0.88
Z1177:Cadps2	UTSW	6	23626695	missense	probably damaging	1.00
Z1177:Cadps2	UTSW	6	23838818	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCAGAGAGATATGCAGGG -3'
(R):5'- CAGTGGAAGCTCATGGTGTTC -3'

Sequencing Primer
(F):5'- CAATTCCATGGTTCCCCAGGATTAAG -3'
(R):5'- CAGTGGAAGCTCATGGTGTTCTTTTG -3'

Posted On

2022-06-15