Incidental Mutation 'R0464:Dusp10'
ID71399
Institutional Source Beutler Lab
Gene Symbol Dusp10
Ensembl Gene ENSMUSG00000039384
Gene Namedual specificity phosphatase 10
SynonymsMKP5, 2610306G15Rik, MKP-5
MMRRC Submission 038664-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.671) question?
Stock #R0464 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location184013302-184075636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 184069076 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 347 (L347I)
Ref Sequence ENSEMBL: ENSMUSP00000045838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048655]
Predicted Effect probably benign
Transcript: ENSMUST00000048655
AA Change: L347I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000045838
Gene: ENSMUSG00000039384
AA Change: L347I

DomainStartEndE-ValueType
low complexity region 33 59 N/A INTRINSIC
low complexity region 92 111 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
RHOD 159 283 1.71e-11 SMART
DSPc 322 462 1.43e-54 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dual specificity protein phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the MAP kinase superfamily, which is associated with cellular proliferation and differentiation. Different members of this family of dual specificity phosphatases show distinct substrate specificities for MAP kinases, different tissue distribution and subcellular localization, and different modes of expression induction by extracellular stimuli. This gene product binds to and inactivates p38 and SAPK/JNK. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display alterations in both innate and adaptive immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,437 L28P probably damaging Het
Ada G T 2: 163,732,964 Y84* probably null Het
Adar T A 3: 89,735,582 C257S possibly damaging Het
Adgrd1 G T 5: 129,162,650 C507F probably damaging Het
Atp5a1 T C 18: 77,779,922 Y299H probably benign Het
Bok G T 1: 93,694,213 R77L probably damaging Het
Cdx2 C A 5: 147,306,473 K170N possibly damaging Het
Ceacam1 A G 7: 25,472,017 S341P possibly damaging Het
Cfhr3 A T 1: 139,593,945 noncoding transcript Het
Ckap5 A G 2: 91,579,513 I947V probably benign Het
Clec2i T C 6: 128,895,423 Y173H probably damaging Het
Cttnbp2 T C 6: 18,408,691 D977G possibly damaging Het
Cyp2f2 C A 7: 27,132,537 Q406K probably benign Het
Ddx28 A G 8: 106,010,053 S458P probably damaging Het
Dppa3 T A 6: 122,628,533 probably null Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fbxl15 A T 19: 46,328,512 E13D probably benign Het
Fhit T A 14: 10,991,567 probably benign Het
Fras1 G T 5: 96,636,803 V882F probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gabbr1 C T 17: 37,050,834 probably benign Het
Ganc T A 2: 120,436,694 V497D probably benign Het
Glt8d2 T G 10: 82,654,730 H242P possibly damaging Het
Gm906 A G 13: 50,248,275 probably benign Het
Gna15 T C 10: 81,512,504 Y131C probably benign Het
Gpatch8 T C 11: 102,480,886 K609E unknown Het
Gprc5a A T 6: 135,079,415 K287* probably null Het
Iqub T A 6: 24,479,263 K427* probably null Het
Itpr2 C G 6: 146,375,889 D666H probably damaging Het
Kcnj5 T C 9: 32,322,973 I15M possibly damaging Het
Kcnn2 A G 18: 45,560,359 E334G probably damaging Het
Lypd6 T A 2: 50,190,678 I126N probably damaging Het
Mtus1 T C 8: 41,002,474 D56G probably damaging Het
Myo1h A G 5: 114,360,510 D889G probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nab1 T C 1: 52,490,015 D241G possibly damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncbp3 C T 11: 73,069,821 probably benign Het
Nek1 T A 8: 61,072,273 probably benign Het
Nf1 T C 11: 79,556,789 V2452A probably benign Het
Nlrp1b A C 11: 71,218,244 S144A probably damaging Het
Npr2 A T 4: 43,640,597 probably null Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC "TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC,TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC" X: 143,743,893 probably benign Het
Paox T A 7: 140,129,282 probably benign Het
Pcdh15 T A 10: 74,626,844 probably null Het
Pde8b G A 13: 95,104,698 T202M probably damaging Het
Pigo A T 4: 43,019,814 V905D probably benign Het
Pik3cb A G 9: 99,044,743 probably null Het
Rassf5 T C 1: 131,212,261 N87S probably benign Het
Rbl1 C A 2: 157,147,545 K1051N probably damaging Het
Rfx7 T C 9: 72,618,204 V892A probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rnf144b T A 13: 47,242,887 Y233* probably null Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sbf2 T C 7: 110,464,576 probably benign Het
Sgo2a A T 1: 58,000,094 K85N probably damaging Het
Siglec1 A T 2: 131,079,359 C631S probably damaging Het
Simc1 C T 13: 54,537,100 R50* probably null Het
Skint5 T A 4: 113,535,731 M1235L unknown Het
Slc22a19 A T 19: 7,682,913 N377K probably benign Het
Spata31d1a A G 13: 59,701,759 F852L possibly damaging Het
Srbd1 G A 17: 86,120,002 S401F probably damaging Het
Stk36 C A 1: 74,611,172 Q288K probably damaging Het
Styx T C 14: 45,372,451 S191P probably benign Het
Supt6 T A 11: 78,216,338 N1214I probably benign Het
Tcim T A 8: 24,438,628 D90V probably damaging Het
Tdpoz1 T A 3: 93,671,475 M1L probably damaging Het
Tep1 T A 14: 50,847,684 T881S probably benign Het
Tlr5 C T 1: 182,973,710 A193V probably benign Het
Tmem117 T A 15: 94,714,919 F112Y probably damaging Het
Tnrc6c C T 11: 117,760,549 R1633W probably damaging Het
Trh T C 6: 92,243,668 probably null Het
Triobp A G 15: 78,966,986 R447G possibly damaging Het
Trip6 A G 5: 137,313,681 F46S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Usp33 T C 3: 152,376,235 probably benign Het
Vmn2r60 A T 7: 42,135,831 I156F probably damaging Het
Wdr17 T C 8: 54,670,392 probably benign Het
Wdr35 G T 12: 9,027,472 probably benign Het
Wwp1 C T 4: 19,638,763 probably benign Het
Zfp652 T C 11: 95,763,649 C293R probably damaging Het
Other mutations in Dusp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Dusp10 APN 1 184069131 missense probably benign 0.00
IGL01094:Dusp10 APN 1 184037500 unclassified probably null
IGL01380:Dusp10 APN 1 184069014 missense possibly damaging 0.93
FR4449:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
FR4548:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
FR4737:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
FR4976:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
LCD18:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
R0369:Dusp10 UTSW 1 184069056 missense probably damaging 1.00
R0433:Dusp10 UTSW 1 184069196 missense probably damaging 1.00
R1112:Dusp10 UTSW 1 184036900 missense probably damaging 0.98
R1474:Dusp10 UTSW 1 184037448 unclassified probably null
R1667:Dusp10 UTSW 1 184036858 missense probably damaging 1.00
R1719:Dusp10 UTSW 1 184037225 missense probably benign 0.22
R1899:Dusp10 UTSW 1 184069180 missense possibly damaging 0.64
R5238:Dusp10 UTSW 1 184037013 missense possibly damaging 0.94
R5277:Dusp10 UTSW 1 184037007 missense possibly damaging 0.94
R5742:Dusp10 UTSW 1 184037656 splice site probably null
R5948:Dusp10 UTSW 1 184068876 missense probably benign
R6890:Dusp10 UTSW 1 184069196 missense probably damaging 1.00
R6969:Dusp10 UTSW 1 184068888 missense probably damaging 1.00
R7007:Dusp10 UTSW 1 184037217 missense probably benign 0.22
R7033:Dusp10 UTSW 1 184037605 missense possibly damaging 0.94
R7436:Dusp10 UTSW 1 184069221 missense probably damaging 1.00
R7447:Dusp10 UTSW 1 184068956 missense probably benign
R7479:Dusp10 UTSW 1 184037420 missense probably damaging 0.99
R7572:Dusp10 UTSW 1 184074309 missense probably damaging 1.00
Z1177:Dusp10 UTSW 1 184068992 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGAAACCTCTGTGACAACTCCCTC -3'
(R):5'- TGCCCATCCAGGTAGTTCTGAGAC -3'

Sequencing Primer
(F):5'- TCCCTCCAGCTCCAAGAGTG -3'
(R):5'- gttgttgttgttgttattgttgttg -3'
Posted On2013-09-30