Incidental Mutation 'R9447:Fcho1'
ID 714002
Institutional Source Beutler Lab
Gene Symbol Fcho1
Ensembl Gene ENSMUSG00000070000
Gene Name FCH domain only 1
Synonyms 3322402E17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock # R9447 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71708387-71725716 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71717269 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 70 (L70P)
Ref Sequence ENSEMBL: ENSMUSP00000117606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093444] [ENSMUST00000125092] [ENSMUST00000136640] [ENSMUST00000146100] [ENSMUST00000153800]
AlphaFold Q8K285
Predicted Effect probably damaging
Transcript: ENSMUST00000093444
AA Change: L70P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091151
Gene: ENSMUSG00000070000
AA Change: L70P

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 4.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123425
SMART Domains Protein: ENSMUSP00000123631
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125092
AA Change: L70P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123554
Gene: ENSMUSG00000070000
AA Change: L70P

DomainStartEndE-ValueType
FCH 6 88 7.62e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136640
AA Change: L70P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119273
Gene: ENSMUSG00000070000
AA Change: L70P

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146100
AA Change: L70P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117606
Gene: ENSMUSG00000070000
AA Change: L70P

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 1.4e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153800
AA Change: L70P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116135
Gene: ENSMUSG00000070000
AA Change: L70P

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 G A 4: 126,508,358 P572S probably benign Het
Akr1c19 A G 13: 4,246,839 I295V probably benign Het
Cadps2 A T 6: 23,323,298 I1007K probably damaging Het
Ccdc144b A G 3: 36,020,046 V318A possibly damaging Het
Cd47 C A 16: 49,895,459 T196K Het
Cdrt4 T G 11: 62,992,592 L40R probably damaging Het
Cox16 A T 12: 81,359,335 C72S probably benign Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Daxx A T 17: 33,913,273 D497V unknown Het
Ddt A G 10: 75,772,837 V62A possibly damaging Het
Dhx57 A G 17: 80,242,094 V1294A probably damaging Het
Dnaaf5 A G 5: 139,177,988 T667A probably damaging Het
Dnase2a A C 8: 84,909,157 S90R probably damaging Het
Dytn A G 1: 63,661,143 V276A Het
Efcab8 G C 2: 153,804,941 V397L unknown Het
Enpp6 A T 8: 47,030,565 R131W probably damaging Het
Epm2a C T 10: 11,448,688 H174Y possibly damaging Het
Fam160a2 G T 7: 105,384,948 T492K probably benign Het
Fstl4 G T 11: 53,186,339 C641F probably damaging Het
Ganab C T 19: 8,909,530 H327Y probably damaging Het
Gkn1 A G 6: 87,346,340 Y164H probably benign Het
Gm10037 A G 13: 67,833,834 E55G probably damaging Het
Gm5538 T A 3: 59,743,630 Y58N probably damaging Het
Hpf1 A G 8: 60,895,584 D111G probably damaging Het
Hs3st2 C T 7: 121,393,066 R113W probably damaging Het
Ighm A T 12: 113,421,174 L353Q Het
Ksr1 T C 11: 79,018,333 D782G unknown Het
Lpin2 A G 17: 71,232,092 K392E unknown Het
Lrrc4 A G 6: 28,830,651 S322P probably benign Het
Man2a1 T C 17: 64,659,006 V313A possibly damaging Het
Mctp1 A G 13: 76,579,785 S9G probably benign Het
Morn5 A T 2: 36,079,513 probably null Het
Mroh2b C T 15: 4,931,341 A795V probably damaging Het
Ncf4 G T 15: 78,262,299 A310S probably benign Het
Nedd4 T C 9: 72,670,099 Y69H probably benign Het
Nras T C 3: 103,060,357 F90L possibly damaging Het
Nrxn3 T C 12: 89,254,908 F113L probably benign Het
Ntsr1 C T 2: 180,538,747 T282I probably benign Het
Olfr396-ps1 G T 11: 73,928,791 C189F probably benign Het
Osbpl3 T A 6: 50,344,877 K310* probably null Het
Pcca T C 14: 122,616,878 V194A probably damaging Het
Plekha5 A G 6: 140,579,466 Y900C probably damaging Het
Prss22 T C 17: 23,993,863 D300G probably benign Het
Rad17 A T 13: 100,627,611 Y451N probably damaging Het
Rnf181 G T 6: 72,360,587 T97K probably damaging Het
Sec24d T C 3: 123,290,513 S114P probably benign Het
Siae C A 9: 37,646,447 Q517K probably benign Het
Smurf2 A T 11: 106,824,722 V653D probably damaging Het
Sqor C A 2: 122,807,600 T359K possibly damaging Het
Taf6 A T 5: 138,178,708 *637R probably null Het
Tas2r109 A C 6: 132,980,307 M220R probably damaging Het
Tlr2 T A 3: 83,841,138 probably null Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem8b T G 4: 43,685,766 L179R probably damaging Het
Tnfrsf10b T A 14: 69,776,159 H179Q probably damaging Het
Trip11 T A 12: 101,883,889 K1305N probably damaging Het
Ttn C A 2: 76,752,518 W22677L probably damaging Het
Ube2r2 T C 4: 41,190,655 V183A probably damaging Het
Ubqln4 T A 3: 88,556,817 D208E probably benign Het
Ugt2a3 T A 5: 87,325,471 N529I probably benign Het
Vmn1r125 A G 7: 21,272,702 N175S probably benign Het
Xirp2 T A 2: 67,508,606 I397K probably damaging Het
Zfp821 G A 8: 109,724,184 V270I probably damaging Het
Zfp935 A G 13: 62,455,028 V99A possibly damaging Het
Other mutations in Fcho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Fcho1 APN 8 71713523 nonsense probably null
IGL01291:Fcho1 APN 8 71712547 missense probably benign 0.08
IGL01473:Fcho1 APN 8 71712138 missense probably benign 0.03
IGL02021:Fcho1 APN 8 71721275 missense probably benign 0.06
IGL02086:Fcho1 APN 8 71716800 missense probably damaging 1.00
IGL02808:Fcho1 APN 8 71712541 missense possibly damaging 0.89
IGL03146:Fcho1 APN 8 71717430 splice site probably benign
IGL03267:Fcho1 APN 8 71712299 unclassified probably benign
cameo UTSW 8 71716863 missense possibly damaging 0.92
Lesser UTSW 8 71712560 missense probably benign 0.00
Sidekick UTSW 8 71715725 missense probably damaging 1.00
ANU05:Fcho1 UTSW 8 71712547 missense probably benign 0.08
R0003:Fcho1 UTSW 8 71708953 missense probably damaging 1.00
R0010:Fcho1 UTSW 8 71709999 missense probably damaging 1.00
R0020:Fcho1 UTSW 8 71716870 missense probably benign 0.11
R0363:Fcho1 UTSW 8 71717490 missense probably damaging 1.00
R0457:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0485:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0501:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0502:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0551:Fcho1 UTSW 8 71712174 missense probably benign 0.06
R0583:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0584:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0585:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0612:Fcho1 UTSW 8 71715524 missense probably damaging 1.00
R0614:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0647:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0841:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0842:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1034:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1036:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1399:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1618:Fcho1 UTSW 8 71710403 missense probably damaging 0.98
R1754:Fcho1 UTSW 8 71711246 missense probably benign
R1793:Fcho1 UTSW 8 71709022 nonsense probably null
R2073:Fcho1 UTSW 8 71710489 missense probably damaging 0.98
R2177:Fcho1 UTSW 8 71712261 missense probably damaging 1.00
R4072:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4074:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4076:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4606:Fcho1 UTSW 8 71712480 missense probably benign
R4732:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4733:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R5082:Fcho1 UTSW 8 71717185 missense possibly damaging 0.69
R5083:Fcho1 UTSW 8 71717176 missense probably benign 0.00
R5185:Fcho1 UTSW 8 71714956 unclassified probably benign
R6025:Fcho1 UTSW 8 71712573 splice site probably null
R6624:Fcho1 UTSW 8 71709371 missense probably damaging 0.99
R6875:Fcho1 UTSW 8 71714425 splice site probably null
R7069:Fcho1 UTSW 8 71710497 splice site probably null
R7476:Fcho1 UTSW 8 71713546 missense probably damaging 1.00
R7512:Fcho1 UTSW 8 71716863 missense possibly damaging 0.92
R7951:Fcho1 UTSW 8 71712276 missense probably benign 0.00
R8699:Fcho1 UTSW 8 71709633 missense possibly damaging 0.63
R8938:Fcho1 UTSW 8 71717146 missense possibly damaging 0.96
R9090:Fcho1 UTSW 8 71710424 missense possibly damaging 0.80
R9117:Fcho1 UTSW 8 71712068 missense possibly damaging 0.87
R9119:Fcho1 UTSW 8 71712068 missense possibly damaging 0.87
R9271:Fcho1 UTSW 8 71710424 missense possibly damaging 0.80
R9433:Fcho1 UTSW 8 71716824 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TACACAAGCTCATCTGGGGTC -3'
(R):5'- GGCCAAACTCTCCAAGCTAG -3'

Sequencing Primer
(F):5'- TCATCTGGGGTCCCGGGAG -3'
(R):5'- TAGCCAGCAACGGGACC -3'
Posted On 2022-06-15