Mutagenetix > Incidental Mutation

Incidental Mutation 'R9447:Mroh2b'

714025

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R9447 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 4931341 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 795 (A795V)

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

AlphaFold

Q7M6Y6

Predicted Effect

probably damaging
Transcript: ENSMUST00000045736
AA Change: A795V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: A795V

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago4	G	A	4: 126,508,358	P572S	probably benign	Het
Akr1c19	A	G	13: 4,246,839	I295V	probably benign	Het
Cadps2	A	T	6: 23,323,298	I1007K	probably damaging	Het
Ccdc144b	A	G	3: 36,020,046	V318A	possibly damaging	Het
Cd47	C	A	16: 49,895,459	T196K		Het
Cdrt4	T	G	11: 62,992,592	L40R	probably damaging	Het
Cox16	A	T	12: 81,359,335	C72S	probably benign	Het
Cyp2t4	G	A	7: 27,155,292	V66M	possibly damaging	Het
Daxx	A	T	17: 33,913,273	D497V	unknown	Het
Ddt	A	G	10: 75,772,837	V62A	possibly damaging	Het
Dhx57	A	G	17: 80,242,094	V1294A	probably damaging	Het
Dnaaf5	A	G	5: 139,177,988	T667A	probably damaging	Het
Dnase2a	A	C	8: 84,909,157	S90R	probably damaging	Het
Dytn	A	G	1: 63,661,143	V276A		Het
Efcab8	G	C	2: 153,804,941	V397L	unknown	Het
Enpp6	A	T	8: 47,030,565	R131W	probably damaging	Het
Epm2a	C	T	10: 11,448,688	H174Y	possibly damaging	Het
Fam160a2	G	T	7: 105,384,948	T492K	probably benign	Het
Fcho1	A	G	8: 71,717,269	L70P	probably damaging	Het
Fstl4	G	T	11: 53,186,339	C641F	probably damaging	Het
Ganab	C	T	19: 8,909,530	H327Y	probably damaging	Het
Gkn1	A	G	6: 87,346,340	Y164H	probably benign	Het
Gm10037	A	G	13: 67,833,834	E55G	probably damaging	Het
Gm5538	T	A	3: 59,743,630	Y58N	probably damaging	Het
Hpf1	A	G	8: 60,895,584	D111G	probably damaging	Het
Hs3st2	C	T	7: 121,393,066	R113W	probably damaging	Het
Ighm	A	T	12: 113,421,174	L353Q		Het
Ksr1	T	C	11: 79,018,333	D782G	unknown	Het
Lpin2	A	G	17: 71,232,092	K392E	unknown	Het
Lrrc4	A	G	6: 28,830,651	S322P	probably benign	Het
Man2a1	T	C	17: 64,659,006	V313A	possibly damaging	Het
Mctp1	A	G	13: 76,579,785	S9G	probably benign	Het
Morn5	A	T	2: 36,079,513		probably null	Het
Ncf4	G	T	15: 78,262,299	A310S	probably benign	Het
Nedd4	T	C	9: 72,670,099	Y69H	probably benign	Het
Nras	T	C	3: 103,060,357	F90L	possibly damaging	Het
Nrxn3	T	C	12: 89,254,908	F113L	probably benign	Het
Ntsr1	C	T	2: 180,538,747	T282I	probably benign	Het
Olfr396-ps1	G	T	11: 73,928,791	C189F	probably benign	Het
Osbpl3	T	A	6: 50,344,877	K310*	probably null	Het
Pcca	T	C	14: 122,616,878	V194A	probably damaging	Het
Plekha5	A	G	6: 140,579,466	Y900C	probably damaging	Het
Prss22	T	C	17: 23,993,863	D300G	probably benign	Het
Rad17	A	T	13: 100,627,611	Y451N	probably damaging	Het
Rnf181	G	T	6: 72,360,587	T97K	probably damaging	Het
Sec24d	T	C	3: 123,290,513	S114P	probably benign	Het
Siae	C	A	9: 37,646,447	Q517K	probably benign	Het
Smurf2	A	T	11: 106,824,722	V653D	probably damaging	Het
Sqor	C	A	2: 122,807,600	T359K	possibly damaging	Het
Taf6	A	T	5: 138,178,708	*637R	probably null	Het
Tas2r109	A	C	6: 132,980,307	M220R	probably damaging	Het
Tlr2	T	A	3: 83,841,138		probably null	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Tmem8b	T	G	4: 43,685,766	L179R	probably damaging	Het
Tnfrsf10b	T	A	14: 69,776,159	H179Q	probably damaging	Het
Trip11	T	A	12: 101,883,889	K1305N	probably damaging	Het
Ttn	C	A	2: 76,752,518	W22677L	probably damaging	Het
Ube2r2	T	C	4: 41,190,655	V183A	probably damaging	Het
Ubqln4	T	A	3: 88,556,817	D208E	probably benign	Het
Ugt2a3	T	A	5: 87,325,471	N529I	probably benign	Het
Vmn1r125	A	G	7: 21,272,702	N175S	probably benign	Het
Xirp2	T	A	2: 67,508,606	I397K	probably damaging	Het
Zfp821	G	A	8: 109,724,184	V270I	probably damaging	Het
Zfp935	A	G	13: 62,455,028	V99A	possibly damaging	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	splice site	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R7995:Mroh2b	UTSW	15	4921357	nonsense	probably null
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8316:Mroh2b	UTSW	15	4951264	nonsense	probably null
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
R8507:Mroh2b	UTSW	15	4949090	missense	probably damaging	1.00
R8728:Mroh2b	UTSW	15	4905640	missense	probably damaging	1.00
R8747:Mroh2b	UTSW	15	4935300	missense	probably damaging	0.99
R8798:Mroh2b	UTSW	15	4948709	missense	probably damaging	1.00
R8814:Mroh2b	UTSW	15	4941625	missense	possibly damaging	0.61
R8856:Mroh2b	UTSW	15	4931028	nonsense	probably null
R8910:Mroh2b	UTSW	15	4931373	missense	probably benign	0.01
R8913:Mroh2b	UTSW	15	4917528	intron	probably benign
R8941:Mroh2b	UTSW	15	4962124	missense	possibly damaging	0.86
R9014:Mroh2b	UTSW	15	4899188	start codon destroyed	probably null	0.95
R9086:Mroh2b	UTSW	15	4953272	critical splice acceptor site	probably null
R9101:Mroh2b	UTSW	15	4900453	missense	probably benign	0.20
R9118:Mroh2b	UTSW	15	4962091	missense	possibly damaging	0.86
R9393:Mroh2b	UTSW	15	4951184	missense	probably benign
R9429:Mroh2b	UTSW	15	4934425	missense	probably damaging	1.00
R9431:Mroh2b	UTSW	15	4934470	missense	probably damaging	1.00
R9443:Mroh2b	UTSW	15	4944339	missense	probably damaging	1.00
R9497:Mroh2b	UTSW	15	4921363	missense	probably damaging	0.98
R9588:Mroh2b	UTSW	15	4948648	missense	not run
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCCAAGTGTTCCATGTAAAAGTG -3'
(R):5'- AACTGCAATGGGGAATATGACTC -3'

Sequencing Primer
(F):5'- CAAGTGTTCCATGTAAAAGTGATGAC -3'
(R):5'- CCTGGTCAAAACTGTGAAGTC -3'

Posted On

2022-06-15