Incidental Mutation 'R9447:Mroh2b'
ID 714025
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Name maestro heat-like repeat family member 2B
Synonyms 4930455B06Rik, Heatr7b2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock # R9447 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 4898737-4962205 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 4931341 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 795 (A795V)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
AlphaFold Q7M6Y6
Predicted Effect probably damaging
Transcript: ENSMUST00000045736
AA Change: A795V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: A795V

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 G A 4: 126,508,358 P572S probably benign Het
Akr1c19 A G 13: 4,246,839 I295V probably benign Het
Cadps2 A T 6: 23,323,298 I1007K probably damaging Het
Ccdc144b A G 3: 36,020,046 V318A possibly damaging Het
Cd47 C A 16: 49,895,459 T196K Het
Cdrt4 T G 11: 62,992,592 L40R probably damaging Het
Cox16 A T 12: 81,359,335 C72S probably benign Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Daxx A T 17: 33,913,273 D497V unknown Het
Ddt A G 10: 75,772,837 V62A possibly damaging Het
Dhx57 A G 17: 80,242,094 V1294A probably damaging Het
Dnaaf5 A G 5: 139,177,988 T667A probably damaging Het
Dnase2a A C 8: 84,909,157 S90R probably damaging Het
Dytn A G 1: 63,661,143 V276A Het
Efcab8 G C 2: 153,804,941 V397L unknown Het
Enpp6 A T 8: 47,030,565 R131W probably damaging Het
Epm2a C T 10: 11,448,688 H174Y possibly damaging Het
Fam160a2 G T 7: 105,384,948 T492K probably benign Het
Fcho1 A G 8: 71,717,269 L70P probably damaging Het
Fstl4 G T 11: 53,186,339 C641F probably damaging Het
Ganab C T 19: 8,909,530 H327Y probably damaging Het
Gkn1 A G 6: 87,346,340 Y164H probably benign Het
Gm10037 A G 13: 67,833,834 E55G probably damaging Het
Gm5538 T A 3: 59,743,630 Y58N probably damaging Het
Hpf1 A G 8: 60,895,584 D111G probably damaging Het
Hs3st2 C T 7: 121,393,066 R113W probably damaging Het
Ighm A T 12: 113,421,174 L353Q Het
Ksr1 T C 11: 79,018,333 D782G unknown Het
Lpin2 A G 17: 71,232,092 K392E unknown Het
Lrrc4 A G 6: 28,830,651 S322P probably benign Het
Man2a1 T C 17: 64,659,006 V313A possibly damaging Het
Mctp1 A G 13: 76,579,785 S9G probably benign Het
Morn5 A T 2: 36,079,513 probably null Het
Ncf4 G T 15: 78,262,299 A310S probably benign Het
Nedd4 T C 9: 72,670,099 Y69H probably benign Het
Nras T C 3: 103,060,357 F90L possibly damaging Het
Nrxn3 T C 12: 89,254,908 F113L probably benign Het
Ntsr1 C T 2: 180,538,747 T282I probably benign Het
Olfr396-ps1 G T 11: 73,928,791 C189F probably benign Het
Osbpl3 T A 6: 50,344,877 K310* probably null Het
Pcca T C 14: 122,616,878 V194A probably damaging Het
Plekha5 A G 6: 140,579,466 Y900C probably damaging Het
Prss22 T C 17: 23,993,863 D300G probably benign Het
Rad17 A T 13: 100,627,611 Y451N probably damaging Het
Rnf181 G T 6: 72,360,587 T97K probably damaging Het
Sec24d T C 3: 123,290,513 S114P probably benign Het
Siae C A 9: 37,646,447 Q517K probably benign Het
Smurf2 A T 11: 106,824,722 V653D probably damaging Het
Sqor C A 2: 122,807,600 T359K possibly damaging Het
Taf6 A T 5: 138,178,708 *637R probably null Het
Tas2r109 A C 6: 132,980,307 M220R probably damaging Het
Tlr2 T A 3: 83,841,138 probably null Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem8b T G 4: 43,685,766 L179R probably damaging Het
Tnfrsf10b T A 14: 69,776,159 H179Q probably damaging Het
Trip11 T A 12: 101,883,889 K1305N probably damaging Het
Ttn C A 2: 76,752,518 W22677L probably damaging Het
Ube2r2 T C 4: 41,190,655 V183A probably damaging Het
Ubqln4 T A 3: 88,556,817 D208E probably benign Het
Ugt2a3 T A 5: 87,325,471 N529I probably benign Het
Vmn1r125 A G 7: 21,272,702 N175S probably benign Het
Xirp2 T A 2: 67,508,606 I397K probably damaging Het
Zfp821 G A 8: 109,724,184 V270I probably damaging Het
Zfp935 A G 13: 62,455,028 V99A possibly damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 splice site probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
R7848:Mroh2b UTSW 15 4938379 nonsense probably null
R7952:Mroh2b UTSW 15 4951211 missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4921357 nonsense probably null
R8088:Mroh2b UTSW 15 4900503 missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4938410 missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4909040 missense probably benign 0.04
R8248:Mroh2b UTSW 15 4931104 missense probably benign 0.40
R8258:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8259:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8304:Mroh2b UTSW 15 4925637 missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4951264 nonsense probably null
R8345:Mroh2b UTSW 15 4944326 missense probably benign 0.09
R8507:Mroh2b UTSW 15 4949090 missense probably damaging 1.00
R8728:Mroh2b UTSW 15 4905640 missense probably damaging 1.00
R8747:Mroh2b UTSW 15 4935300 missense probably damaging 0.99
R8798:Mroh2b UTSW 15 4948709 missense probably damaging 1.00
R8814:Mroh2b UTSW 15 4941625 missense possibly damaging 0.61
R8856:Mroh2b UTSW 15 4931028 nonsense probably null
R8910:Mroh2b UTSW 15 4931373 missense probably benign 0.01
R8913:Mroh2b UTSW 15 4917528 intron probably benign
R8941:Mroh2b UTSW 15 4962124 missense possibly damaging 0.86
R9014:Mroh2b UTSW 15 4899188 start codon destroyed probably null 0.95
R9086:Mroh2b UTSW 15 4953272 critical splice acceptor site probably null
R9101:Mroh2b UTSW 15 4900453 missense probably benign 0.20
R9118:Mroh2b UTSW 15 4962091 missense possibly damaging 0.86
R9393:Mroh2b UTSW 15 4951184 missense probably benign
R9429:Mroh2b UTSW 15 4934425 missense probably damaging 1.00
R9431:Mroh2b UTSW 15 4934470 missense probably damaging 1.00
R9443:Mroh2b UTSW 15 4944339 missense probably damaging 1.00
R9497:Mroh2b UTSW 15 4921363 missense probably damaging 0.98
R9588:Mroh2b UTSW 15 4948648 missense not run
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4905005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCAAGTGTTCCATGTAAAAGTG -3'
(R):5'- AACTGCAATGGGGAATATGACTC -3'

Sequencing Primer
(F):5'- CAAGTGTTCCATGTAAAAGTGATGAC -3'
(R):5'- CCTGGTCAAAACTGTGAAGTC -3'
Posted On 2022-06-15