Incidental Mutation 'R9448:Nlrp4e'
ID 714062
Institutional Source Beutler Lab
Gene Symbol Nlrp4e
Ensembl Gene ENSMUSG00000045693
Gene Name NLR family, pyrin domain containing 4E
Synonyms 4930406H16Rik, Nalp4e, Nalp-epsilon
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9448 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 23301192-23362277 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23301531 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 84 (M84L)
Ref Sequence ENSEMBL: ENSMUSP00000075794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076470]
AlphaFold Q66X19
Predicted Effect probably benign
Transcript: ENSMUST00000076470
AA Change: M84L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075794
Gene: ENSMUSG00000045693
AA Change: M84L

DomainStartEndE-ValueType
PYRIN 6 89 1.43e-35 SMART
Pfam:NACHT 148 317 1.3e-39 PFAM
LRR 689 716 1.87e1 SMART
LRR 718 745 7.74e0 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 2.67e1 SMART
LRR 802 829 6.48e-1 SMART
LRR 831 858 2.03e0 SMART
LRR 859 886 2.88e-6 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 1.02e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G T 9: 103,272,582 Q259K probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Adcy1 T C 11: 7,149,575 V685A possibly damaging Het
Atg9a G T 1: 75,186,205 T417K probably benign Het
Atp6v1a T A 16: 44,111,509 K139* probably null Het
Baz1b T C 5: 135,210,802 I252T probably damaging Het
Ccdc191 T A 16: 43,938,975 W380R Het
Cep290 T G 10: 100,559,684 V2118G probably benign Het
Crb2 A G 2: 37,787,761 D352G probably benign Het
Csmd3 T C 15: 47,596,919 D2581G Het
Diras2 T A 13: 52,508,086 T62S possibly damaging Het
Dmrt1 T C 19: 25,545,891 V202A possibly damaging Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
Dph7 A T 2: 24,971,940 K455M probably damaging Het
Efcab8 G C 2: 153,804,941 V397L unknown Het
Ehbp1 T C 11: 22,137,881 N426S probably benign Het
Exo5 A G 4: 120,921,691 W326R probably damaging Het
Fam149a T A 8: 45,339,374 probably null Het
Fam205a1 A T 4: 42,850,250 Y635* probably null Het
Flii T C 11: 60,715,567 N1099S probably benign Het
Flvcr1 T C 1: 191,012,209 T381A possibly damaging Het
Foxl1 T C 8: 121,128,869 V303A probably benign Het
Fsd1l G T 4: 53,694,826 E427* probably null Het
Galnt18 A T 7: 111,554,442 I325N probably damaging Het
Gm12394 T C 4: 42,793,440 R231G probably benign Het
Gm5478 T C 15: 101,645,227 N274S probably damaging Het
Grm7 A T 6: 111,358,232 T535S probably benign Het
Heatr5b T C 17: 78,760,586 D1791G probably benign Het
Igkv12-98 T C 6: 68,571,172 I95T probably damaging Het
Il1rl2 A G 1: 40,327,444 Y46C probably benign Het
Kdr T C 5: 75,941,909 E1186G probably benign Het
Knstrn T C 2: 118,814,494 probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Ltbp1 C T 17: 75,359,460 Q1383* probably null Het
Mep1a T C 17: 43,494,978 probably null Het
Mep1b A G 18: 21,084,142 D106G probably damaging Het
Moxd2 T C 6: 40,887,226 N90S probably benign Het
Ms4a4c T A 19: 11,414,953 probably null Het
Noc2l C A 4: 156,236,324 R66S probably benign Het
Nox4 A T 7: 87,395,793 L580F unknown Het
Numb A G 12: 83,842,216 probably null Het
Olfr1136 A T 2: 87,693,480 V134E probably damaging Het
Olfr365 A G 2: 37,201,209 probably benign Het
Parp8 T A 13: 116,902,824 K274* probably null Het
Pcdh1 G A 18: 38,197,439 P976L probably damaging Het
Pcnt T C 10: 76,420,526 K627E probably damaging Het
Pdzk1 A T 3: 96,854,606 D178V probably damaging Het
Phldb1 G T 9: 44,711,249 L36M possibly damaging Het
Pip5k1c A G 10: 81,305,811 E111G probably damaging Het
Plcb4 G A 2: 135,910,125 E84K possibly damaging Het
Prpf39 T A 12: 65,061,260 Y646N probably benign Het
Psmc6 T C 14: 45,331,026 F69L probably benign Het
Ptk2 T A 15: 73,343,192 S46C possibly damaging Het
Ptpn6 G A 6: 124,732,808 R23W probably damaging Het
Ptprb T A 10: 116,313,914 Y143* probably null Het
Qrich2 T C 11: 116,447,265 E141G probably benign Het
Rsf1 G GCCGGCGGCT 7: 97,579,909 probably benign Het
Scn5a A G 9: 119,552,061 L136P probably damaging Het
Slc12a6 T C 2: 112,349,359 F676S probably damaging Het
Spata32 C T 11: 103,208,822 G286R probably damaging Het
Tbx19 T C 1: 165,153,521 K135E probably damaging Het
Tdrd6 T C 17: 43,625,676 T1494A probably benign Het
Tmem62 A C 2: 120,977,730 D71A probably damaging Het
Tnfsf15 A T 4: 63,745,068 V6D possibly damaging Het
Tulp4 T C 17: 6,198,673 V182A possibly damaging Het
Vmn2r73 A T 7: 85,872,819 V104D probably benign Het
Zdhhc8 C A 16: 18,221,694 G159C Het
Zfy2 A G Y: 2,109,904 W338R probably damaging Het
Znfx1 T G 2: 167,046,924 Q788P probably benign Het
Zscan26 A G 13: 21,448,261 V100A probably benign Het
Other mutations in Nlrp4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Nlrp4e APN 7 23343140 missense probably damaging 1.00
IGL00833:Nlrp4e APN 7 23340471 missense probably benign 0.00
IGL01017:Nlrp4e APN 7 23321667 missense possibly damaging 0.93
IGL01025:Nlrp4e APN 7 23353161 splice site probably benign
IGL01815:Nlrp4e APN 7 23321438 missense probably benign 0.02
IGL01924:Nlrp4e APN 7 23320830 nonsense probably null
IGL02245:Nlrp4e APN 7 23320875 missense probably damaging 1.00
IGL02745:Nlrp4e APN 7 23321291 missense probably damaging 1.00
IGL02746:Nlrp4e APN 7 23321839 missense probably benign 0.00
IGL02987:Nlrp4e APN 7 23301433 missense probably damaging 1.00
IGL02997:Nlrp4e APN 7 23301374 missense probably benign 0.04
IGL03193:Nlrp4e APN 7 23320826 missense probably damaging 1.00
IGL03304:Nlrp4e APN 7 23353343 critical splice donor site probably null
IGL03352:Nlrp4e APN 7 23320826 missense probably damaging 1.00
R0389:Nlrp4e UTSW 7 23355203 missense probably damaging 0.98
R1028:Nlrp4e UTSW 7 23321744 missense probably damaging 1.00
R1163:Nlrp4e UTSW 7 23320972 missense probably benign 0.03
R1269:Nlrp4e UTSW 7 23353338 missense possibly damaging 0.95
R1400:Nlrp4e UTSW 7 23321660 missense possibly damaging 0.93
R1497:Nlrp4e UTSW 7 23320372 missense probably benign 0.00
R1518:Nlrp4e UTSW 7 23321843 missense probably benign 0.33
R1716:Nlrp4e UTSW 7 23321033 missense possibly damaging 0.56
R1727:Nlrp4e UTSW 7 23320995 missense probably benign 0.01
R1998:Nlrp4e UTSW 7 23321246 missense probably benign 0.00
R2177:Nlrp4e UTSW 7 23355261 missense probably benign 0.00
R3724:Nlrp4e UTSW 7 23321377 missense probably benign 0.28
R3767:Nlrp4e UTSW 7 23340563 missense probably damaging 1.00
R3795:Nlrp4e UTSW 7 23320803 missense probably benign 0.35
R4387:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4387:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4388:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4388:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4389:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4403:Nlrp4e UTSW 7 23321463 nonsense probably null
R4444:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4486:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4547:Nlrp4e UTSW 7 23336866 missense probably benign 0.00
R4553:Nlrp4e UTSW 7 23320979 missense probably benign
R4666:Nlrp4e UTSW 7 23336780 nonsense probably null
R4721:Nlrp4e UTSW 7 23321096 missense possibly damaging 0.84
R4728:Nlrp4e UTSW 7 23321564 missense probably benign
R4758:Nlrp4e UTSW 7 23320618 missense probably benign 0.17
R4775:Nlrp4e UTSW 7 23343100 missense probably benign 0.14
R4830:Nlrp4e UTSW 7 23336740 missense probably benign 0.03
R4954:Nlrp4e UTSW 7 23361893 nonsense probably null
R5277:Nlrp4e UTSW 7 23321438 missense probably benign 0.02
R5352:Nlrp4e UTSW 7 23353173 missense probably benign 0.26
R5521:Nlrp4e UTSW 7 23321765 missense probably benign 0.00
R5528:Nlrp4e UTSW 7 23336891 missense probably benign 0.07
R5537:Nlrp4e UTSW 7 23320489 missense probably benign 0.00
R5584:Nlrp4e UTSW 7 23321177 missense probably benign
R5683:Nlrp4e UTSW 7 23353272 missense probably damaging 0.99
R6160:Nlrp4e UTSW 7 23321306 missense probably damaging 0.99
R6313:Nlrp4e UTSW 7 23353172 missense probably benign
R6427:Nlrp4e UTSW 7 23320633 missense possibly damaging 0.48
R6647:Nlrp4e UTSW 7 23321315 missense probably benign 0.00
R6929:Nlrp4e UTSW 7 23336731 critical splice acceptor site probably null
R7307:Nlrp4e UTSW 7 23321528 missense probably benign 0.07
R7792:Nlrp4e UTSW 7 23321757 missense possibly damaging 0.60
R8169:Nlrp4e UTSW 7 23320506 missense probably benign 0.06
R8445:Nlrp4e UTSW 7 23340540 missense probably benign 0.00
R8487:Nlrp4e UTSW 7 23321558 missense probably benign 0.00
R8906:Nlrp4e UTSW 7 23321131 missense possibly damaging 0.88
R9124:Nlrp4e UTSW 7 23320978 missense probably benign
R9167:Nlrp4e UTSW 7 23340526 missense probably benign 0.00
R9181:Nlrp4e UTSW 7 23361845 nonsense probably null
R9219:Nlrp4e UTSW 7 23321516 missense possibly damaging 0.50
R9229:Nlrp4e UTSW 7 23321374 missense probably benign 0.00
R9321:Nlrp4e UTSW 7 23321330 missense probably benign
R9323:Nlrp4e UTSW 7 23321330 missense probably benign
R9325:Nlrp4e UTSW 7 23321330 missense probably benign
R9379:Nlrp4e UTSW 7 23321330 missense probably benign
R9380:Nlrp4e UTSW 7 23321330 missense probably benign
R9523:Nlrp4e UTSW 7 23355211 missense probably benign 0.00
R9593:Nlrp4e UTSW 7 23320772 missense probably benign 0.19
X0022:Nlrp4e UTSW 7 23343119 missense probably damaging 1.00
X0025:Nlrp4e UTSW 7 23343178 missense possibly damaging 0.91
X0026:Nlrp4e UTSW 7 23355223 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTCCTTAAGACACGATGGCATC -3'
(R):5'- GTGTCTACATGAAGGTGCCTC -3'

Sequencing Primer
(F):5'- TATGTGGTACTTGGAAGAGCTAAAC -3'
(R):5'- GTGCCTCCTTTCCCAAGCATAAG -3'
Posted On 2022-06-15