Incidental Mutation 'R9448:Parp8'
ID 714087
Institutional Source Beutler Lab
Gene Symbol Parp8
Ensembl Gene ENSMUSG00000021725
Gene Name poly (ADP-ribose) polymerase family, member 8
Synonyms D13Ertd275e, 2810430O08Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9448 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 116991356-117162073 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 117039360 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 274 (K274*)
Ref Sequence ENSEMBL: ENSMUSP00000022239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022239] [ENSMUST00000223949] [ENSMUST00000225344] [ENSMUST00000226107]
AlphaFold Q3UD82
Predicted Effect probably null
Transcript: ENSMUST00000022239
AA Change: K274*
SMART Domains Protein: ENSMUSP00000022239
Gene: ENSMUSG00000021725
AA Change: K274*

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
internal_repeat_1 332 410 4.61e-10 PROSPERO
internal_repeat_1 404 476 4.61e-10 PROSPERO
low complexity region 497 514 N/A INTRINSIC
Pfam:PARP 712 839 2e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000223949
AA Change: K235*
Predicted Effect probably benign
Transcript: ENSMUST00000225344
Predicted Effect probably benign
Transcript: ENSMUST00000226107
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Adcy1 T C 11: 7,099,575 (GRCm39) V685A possibly damaging Het
Atg9a G T 1: 75,162,849 (GRCm39) T417K probably benign Het
Atp6v1a T A 16: 43,931,872 (GRCm39) K139* probably null Het
Baz1b T C 5: 135,239,656 (GRCm39) I252T probably damaging Het
Ccdc191 T A 16: 43,759,338 (GRCm39) W380R Het
Cep290 T G 10: 100,395,546 (GRCm39) V2118G probably benign Het
Crb2 A G 2: 37,677,773 (GRCm39) D352G probably benign Het
Csmd3 T C 15: 47,460,315 (GRCm39) D2581G Het
Diras2 T A 13: 52,662,122 (GRCm39) T62S possibly damaging Het
Dmrt1 T C 19: 25,523,255 (GRCm39) V202A possibly damaging Het
Dok1 T C 6: 83,009,972 (GRCm39) K46E probably damaging Het
Dph7 A T 2: 24,861,952 (GRCm39) K455M probably damaging Het
Efcab8 G C 2: 153,646,861 (GRCm39) V397L unknown Het
Ehbp1 T C 11: 22,087,881 (GRCm39) N426S probably benign Het
Exo5 A G 4: 120,778,888 (GRCm39) W326R probably damaging Het
Fam149a T A 8: 45,792,411 (GRCm39) probably null Het
Flii T C 11: 60,606,393 (GRCm39) N1099S probably benign Het
Flvcr1 T C 1: 190,744,406 (GRCm39) T381A possibly damaging Het
Foxl1 T C 8: 121,855,608 (GRCm39) V303A probably benign Het
Fsd1l G T 4: 53,694,826 (GRCm39) E427* probably null Het
Galnt18 A T 7: 111,153,649 (GRCm39) I325N probably damaging Het
Gm5478 T C 15: 101,553,662 (GRCm39) N274S probably damaging Het
Grm7 A T 6: 111,335,193 (GRCm39) T535S probably benign Het
Heatr5b T C 17: 79,068,015 (GRCm39) D1791G probably benign Het
Igkv12-98 T C 6: 68,548,156 (GRCm39) I95T probably damaging Het
Il1rl2 A G 1: 40,366,604 (GRCm39) Y46C probably benign Het
Inhca G T 9: 103,149,781 (GRCm39) Q259K probably benign Het
Kdr T C 5: 76,102,569 (GRCm39) E1186G probably benign Het
Knstrn T C 2: 118,644,975 (GRCm39) probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,079,903 (GRCm39) probably benign Het
Ltbp1 C T 17: 75,666,455 (GRCm39) Q1383* probably null Het
Mep1a T C 17: 43,805,869 (GRCm39) probably null Het
Mep1b A G 18: 21,217,199 (GRCm39) D106G probably damaging Het
Moxd2 T C 6: 40,864,160 (GRCm39) N90S probably benign Het
Ms4a4c T A 19: 11,392,317 (GRCm39) probably null Het
Nlrp4e A T 7: 23,000,956 (GRCm39) M84L probably benign Het
Noc2l C A 4: 156,320,781 (GRCm39) R66S probably benign Het
Nox4 A T 7: 87,045,001 (GRCm39) L580F unknown Het
Numb A G 12: 83,888,990 (GRCm39) probably null Het
Or1l4 A G 2: 37,091,221 (GRCm39) probably benign Het
Or5w13 A T 2: 87,523,824 (GRCm39) V134E probably damaging Het
Pcdh1 G A 18: 38,330,492 (GRCm39) P976L probably damaging Het
Pcnt T C 10: 76,256,360 (GRCm39) K627E probably damaging Het
Pdzk1 A T 3: 96,761,922 (GRCm39) D178V probably damaging Het
Phldb1 G T 9: 44,622,546 (GRCm39) L36M possibly damaging Het
Pip5k1c A G 10: 81,141,645 (GRCm39) E111G probably damaging Het
Plcb4 G A 2: 135,752,045 (GRCm39) E84K possibly damaging Het
Prpf39 T A 12: 65,108,034 (GRCm39) Y646N probably benign Het
Psmc6 T C 14: 45,568,483 (GRCm39) F69L probably benign Het
Ptk2 T A 15: 73,215,041 (GRCm39) S46C possibly damaging Het
Ptpn6 G A 6: 124,709,771 (GRCm39) R23W probably damaging Het
Ptprb T A 10: 116,149,819 (GRCm39) Y143* probably null Het
Qrich2 T C 11: 116,338,091 (GRCm39) E141G probably benign Het
Rsf1 G GCCGGCGGCT 7: 97,229,116 (GRCm39) probably benign Het
Scn5a A G 9: 119,381,127 (GRCm39) L136P probably damaging Het
Slc12a6 T C 2: 112,179,704 (GRCm39) F676S probably damaging Het
Spata31f1a A T 4: 42,850,250 (GRCm39) Y635* probably null Het
Spata31f1e T C 4: 42,793,440 (GRCm39) R231G probably benign Het
Spata32 C T 11: 103,099,648 (GRCm39) G286R probably damaging Het
Tbx19 T C 1: 164,981,090 (GRCm39) K135E probably damaging Het
Tdrd6 T C 17: 43,936,567 (GRCm39) T1494A probably benign Het
Tmem62 A C 2: 120,808,211 (GRCm39) D71A probably damaging Het
Tnfsf15 A T 4: 63,663,305 (GRCm39) V6D possibly damaging Het
Tulp4 T C 17: 6,248,948 (GRCm39) V182A possibly damaging Het
Vmn2r73 A T 7: 85,522,027 (GRCm39) V104D probably benign Het
Zdhhc8 C A 16: 18,039,558 (GRCm39) G159C Het
Zfy2 A G Y: 2,109,904 (GRCm39) W338R probably damaging Het
Znfx1 T G 2: 166,888,844 (GRCm39) Q788P probably benign Het
Zscan26 A G 13: 21,632,431 (GRCm39) V100A probably benign Het
Other mutations in Parp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Parp8 APN 13 117,063,859 (GRCm39) missense probably damaging 1.00
IGL01346:Parp8 APN 13 117,031,600 (GRCm39) missense possibly damaging 0.72
IGL01793:Parp8 APN 13 117,047,415 (GRCm39) missense probably damaging 1.00
IGL01926:Parp8 APN 13 116,998,838 (GRCm39) splice site probably benign
IGL01958:Parp8 APN 13 117,013,108 (GRCm39) missense probably benign 0.14
IGL02131:Parp8 APN 13 117,047,409 (GRCm39) missense probably benign 0.08
IGL02398:Parp8 APN 13 117,047,399 (GRCm39) critical splice donor site probably null
IGL02496:Parp8 APN 13 116,998,838 (GRCm39) splice site probably benign
IGL03135:Parp8 APN 13 117,047,478 (GRCm39) missense probably benign 0.41
IGL03143:Parp8 APN 13 117,047,497 (GRCm39) splice site probably benign
IGL03201:Parp8 APN 13 116,999,605 (GRCm39) splice site probably benign
blondi UTSW 13 117,029,577 (GRCm39) missense possibly damaging 0.77
Heidi UTSW 13 116,998,740 (GRCm39) splice site probably null
R0362:Parp8 UTSW 13 117,061,504 (GRCm39) nonsense probably null
R0699:Parp8 UTSW 13 117,059,120 (GRCm39) missense probably benign 0.01
R1445:Parp8 UTSW 13 117,161,886 (GRCm39) splice site probably null
R1676:Parp8 UTSW 13 117,014,064 (GRCm39) missense probably damaging 0.99
R1977:Parp8 UTSW 13 117,047,449 (GRCm39) missense probably damaging 0.96
R2019:Parp8 UTSW 13 117,004,968 (GRCm39) splice site probably benign
R2049:Parp8 UTSW 13 117,031,422 (GRCm39) missense probably benign 0.20
R2142:Parp8 UTSW 13 117,031,422 (GRCm39) missense probably benign 0.20
R2474:Parp8 UTSW 13 117,029,577 (GRCm39) missense possibly damaging 0.77
R2566:Parp8 UTSW 13 117,032,223 (GRCm39) missense possibly damaging 0.78
R3863:Parp8 UTSW 13 117,031,303 (GRCm39) missense probably benign 0.01
R4126:Parp8 UTSW 13 117,005,005 (GRCm39) missense possibly damaging 0.94
R4518:Parp8 UTSW 13 117,032,209 (GRCm39) missense possibly damaging 0.62
R4519:Parp8 UTSW 13 117,032,209 (GRCm39) missense possibly damaging 0.62
R4767:Parp8 UTSW 13 117,005,072 (GRCm39) missense probably damaging 0.99
R5355:Parp8 UTSW 13 116,998,740 (GRCm39) splice site probably null
R5633:Parp8 UTSW 13 117,013,116 (GRCm39) missense probably damaging 1.00
R5942:Parp8 UTSW 13 117,005,969 (GRCm39) missense probably benign 0.12
R5978:Parp8 UTSW 13 117,032,268 (GRCm39) missense probably benign 0.01
R6039:Parp8 UTSW 13 117,014,134 (GRCm39) missense probably damaging 1.00
R6039:Parp8 UTSW 13 117,014,134 (GRCm39) missense probably damaging 1.00
R6753:Parp8 UTSW 13 117,031,651 (GRCm39) missense possibly damaging 0.91
R7016:Parp8 UTSW 13 117,031,627 (GRCm39) missense probably damaging 1.00
R7139:Parp8 UTSW 13 117,161,802 (GRCm39) missense probably benign 0.21
R7305:Parp8 UTSW 13 117,031,461 (GRCm39) missense possibly damaging 0.95
R7314:Parp8 UTSW 13 117,004,996 (GRCm39) missense probably benign 0.01
R7360:Parp8 UTSW 13 117,032,307 (GRCm39) missense probably benign 0.02
R7526:Parp8 UTSW 13 117,031,341 (GRCm39) missense probably damaging 1.00
R8078:Parp8 UTSW 13 117,061,519 (GRCm39) missense probably damaging 1.00
R8108:Parp8 UTSW 13 117,003,609 (GRCm39) nonsense probably null
R8372:Parp8 UTSW 13 116,991,786 (GRCm39) missense probably damaging 1.00
R9005:Parp8 UTSW 13 117,013,126 (GRCm39) missense probably benign
R9072:Parp8 UTSW 13 117,047,951 (GRCm39) missense probably damaging 1.00
R9073:Parp8 UTSW 13 117,047,951 (GRCm39) missense probably damaging 1.00
R9351:Parp8 UTSW 13 117,000,781 (GRCm39) missense probably damaging 0.99
R9441:Parp8 UTSW 13 117,029,562 (GRCm39) missense probably damaging 1.00
R9470:Parp8 UTSW 13 117,031,292 (GRCm39) missense probably benign 0.02
R9562:Parp8 UTSW 13 117,029,631 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CCAGGTCCACATGAGCAAGAAG -3'
(R):5'- CACAAAGAATGGTGTCCATCC -3'

Sequencing Primer
(F):5'- CTCGAAAGTGAGCTCAGCG -3'
(R):5'- AAGAATGGTGTCCATCCTTCCTGTG -3'
Posted On 2022-06-15