Incidental Mutation 'R9448:Mep1a'
ID 714096
Institutional Source Beutler Lab
Gene Symbol Mep1a
Ensembl Gene ENSMUSG00000023914
Gene Name meprin 1 alpha
Synonyms Mep-1a, meprin A alpha-subunit, Mep1, meprin alpha, Mep-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9448 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 43474324-43502812 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to C at 43494978 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024707] [ENSMUST00000117137]
AlphaFold P28825
Predicted Effect probably null
Transcript: ENSMUST00000024707
SMART Domains Protein: ENSMUSP00000024707
Gene: ENSMUSG00000023914

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
ZnMc 83 222 1.16e-41 SMART
MAM 276 445 5.38e-61 SMART
MATH 445 590 6.9e-17 SMART
EGF 687 724 1.35e-2 SMART
transmembrane domain 727 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117137
SMART Domains Protein: ENSMUSP00000113838
Gene: ENSMUSG00000023914

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
ZnMc 70 209 1.16e-41 SMART
MAM 263 432 5.38e-61 SMART
MATH 432 577 6.9e-17 SMART
EGF 674 711 1.35e-2 SMART
transmembrane domain 714 736 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size, reduced LPS-induced renal injury and bladder inflammation, and increased susceptibility to sodium dextran sulfate-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G T 9: 103,272,582 Q259K probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Adcy1 T C 11: 7,149,575 V685A possibly damaging Het
Atg9a G T 1: 75,186,205 T417K probably benign Het
Atp6v1a T A 16: 44,111,509 K139* probably null Het
Baz1b T C 5: 135,210,802 I252T probably damaging Het
Ccdc191 T A 16: 43,938,975 W380R Het
Cep290 T G 10: 100,559,684 V2118G probably benign Het
Crb2 A G 2: 37,787,761 D352G probably benign Het
Csmd3 T C 15: 47,596,919 D2581G Het
Diras2 T A 13: 52,508,086 T62S possibly damaging Het
Dmrt1 T C 19: 25,545,891 V202A possibly damaging Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
Dph7 A T 2: 24,971,940 K455M probably damaging Het
Efcab8 G C 2: 153,804,941 V397L unknown Het
Ehbp1 T C 11: 22,137,881 N426S probably benign Het
Exo5 A G 4: 120,921,691 W326R probably damaging Het
Fam149a T A 8: 45,339,374 probably null Het
Fam205a1 A T 4: 42,850,250 Y635* probably null Het
Flii T C 11: 60,715,567 N1099S probably benign Het
Flvcr1 T C 1: 191,012,209 T381A possibly damaging Het
Foxl1 T C 8: 121,128,869 V303A probably benign Het
Fsd1l G T 4: 53,694,826 E427* probably null Het
Galnt18 A T 7: 111,554,442 I325N probably damaging Het
Gm12394 T C 4: 42,793,440 R231G probably benign Het
Gm5478 T C 15: 101,645,227 N274S probably damaging Het
Grm7 A T 6: 111,358,232 T535S probably benign Het
Heatr5b T C 17: 78,760,586 D1791G probably benign Het
Igkv12-98 T C 6: 68,571,172 I95T probably damaging Het
Il1rl2 A G 1: 40,327,444 Y46C probably benign Het
Kdr T C 5: 75,941,909 E1186G probably benign Het
Knstrn T C 2: 118,814,494 probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Ltbp1 C T 17: 75,359,460 Q1383* probably null Het
Mep1b A G 18: 21,084,142 D106G probably damaging Het
Moxd2 T C 6: 40,887,226 N90S probably benign Het
Ms4a4c T A 19: 11,414,953 probably null Het
Nlrp4e A T 7: 23,301,531 M84L probably benign Het
Noc2l C A 4: 156,236,324 R66S probably benign Het
Nox4 A T 7: 87,395,793 L580F unknown Het
Numb A G 12: 83,842,216 probably null Het
Olfr1136 A T 2: 87,693,480 V134E probably damaging Het
Olfr365 A G 2: 37,201,209 probably benign Het
Parp8 T A 13: 116,902,824 K274* probably null Het
Pcdh1 G A 18: 38,197,439 P976L probably damaging Het
Pcnt T C 10: 76,420,526 K627E probably damaging Het
Pdzk1 A T 3: 96,854,606 D178V probably damaging Het
Phldb1 G T 9: 44,711,249 L36M possibly damaging Het
Pip5k1c A G 10: 81,305,811 E111G probably damaging Het
Plcb4 G A 2: 135,910,125 E84K possibly damaging Het
Prpf39 T A 12: 65,061,260 Y646N probably benign Het
Psmc6 T C 14: 45,331,026 F69L probably benign Het
Ptk2 T A 15: 73,343,192 S46C possibly damaging Het
Ptpn6 G A 6: 124,732,808 R23W probably damaging Het
Ptprb T A 10: 116,313,914 Y143* probably null Het
Qrich2 T C 11: 116,447,265 E141G probably benign Het
Rsf1 G GCCGGCGGCT 7: 97,579,909 probably benign Het
Scn5a A G 9: 119,552,061 L136P probably damaging Het
Slc12a6 T C 2: 112,349,359 F676S probably damaging Het
Spata32 C T 11: 103,208,822 G286R probably damaging Het
Tbx19 T C 1: 165,153,521 K135E probably damaging Het
Tdrd6 T C 17: 43,625,676 T1494A probably benign Het
Tmem62 A C 2: 120,977,730 D71A probably damaging Het
Tnfsf15 A T 4: 63,745,068 V6D possibly damaging Het
Tulp4 T C 17: 6,198,673 V182A possibly damaging Het
Vmn2r73 A T 7: 85,872,819 V104D probably benign Het
Zdhhc8 C A 16: 18,221,694 G159C Het
Zfy2 A G Y: 2,109,904 W338R probably damaging Het
Znfx1 T G 2: 167,046,924 Q788P probably benign Het
Zscan26 A G 13: 21,448,261 V100A probably benign Het
Other mutations in Mep1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Mep1a APN 17 43479084 missense probably benign 0.00
IGL02814:Mep1a APN 17 43477221 missense probably benign
IGL03000:Mep1a APN 17 43474990 missense probably benign
IGL03335:Mep1a APN 17 43477173 missense possibly damaging 0.63
IGL03410:Mep1a APN 17 43478095 splice site probably null
PIT4544001:Mep1a UTSW 17 43482287 missense probably damaging 1.00
R0127:Mep1a UTSW 17 43497886 splice site probably benign
R0306:Mep1a UTSW 17 43502643 splice site probably benign
R0329:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0330:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0358:Mep1a UTSW 17 43478950 missense possibly damaging 0.92
R0667:Mep1a UTSW 17 43478190 missense probably benign 0.06
R1101:Mep1a UTSW 17 43491693 missense probably benign 0.03
R1458:Mep1a UTSW 17 43491672 missense probably damaging 1.00
R1525:Mep1a UTSW 17 43491636 missense probably damaging 1.00
R1992:Mep1a UTSW 17 43502682 missense probably benign
R2014:Mep1a UTSW 17 43497906 missense probably benign 0.01
R2212:Mep1a UTSW 17 43477263 missense probably benign 0.02
R3946:Mep1a UTSW 17 43475041 nonsense probably null
R4400:Mep1a UTSW 17 43475006 missense possibly damaging 0.77
R4598:Mep1a UTSW 17 43491578 critical splice donor site probably null
R4616:Mep1a UTSW 17 43486241 missense possibly damaging 0.81
R4688:Mep1a UTSW 17 43482248 missense possibly damaging 0.89
R5085:Mep1a UTSW 17 43478144 missense probably damaging 0.99
R5355:Mep1a UTSW 17 43477146 missense probably damaging 0.98
R5832:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5833:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5834:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5835:Mep1a UTSW 17 43478164 missense probably benign 0.27
R6280:Mep1a UTSW 17 43502392 missense probably damaging 1.00
R6340:Mep1a UTSW 17 43479058 missense probably benign 0.00
R6340:Mep1a UTSW 17 43479233 missense probably benign 0.00
R6934:Mep1a UTSW 17 43482230 missense probably damaging 0.99
R7247:Mep1a UTSW 17 43475104 missense possibly damaging 0.67
R7660:Mep1a UTSW 17 43478977 missense probably benign 0.29
R7685:Mep1a UTSW 17 43479174 missense probably benign 0.00
R7703:Mep1a UTSW 17 43478106 missense possibly damaging 0.69
R7871:Mep1a UTSW 17 43479235 missense probably benign 0.33
R8131:Mep1a UTSW 17 43502667 missense probably benign 0.00
R8783:Mep1a UTSW 17 43478190 missense probably benign 0.00
R8880:Mep1a UTSW 17 43497917 missense possibly damaging 0.46
R9455:Mep1a UTSW 17 43494976 missense probably benign 0.00
RF010:Mep1a UTSW 17 43486235 missense probably damaging 0.99
Z1088:Mep1a UTSW 17 43491596 missense probably damaging 1.00
Z1176:Mep1a UTSW 17 43477320 missense probably benign 0.08
Z1177:Mep1a UTSW 17 43486297 missense probably damaging 1.00
Z1177:Mep1a UTSW 17 43486306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGACTGCAAAGATAGCTCAAG -3'
(R):5'- AGGGTCAGACACCTTTAACTAC -3'

Sequencing Primer
(F):5'- CTCAAGAGCTAAGACTTGCTTTTG -3'
(R):5'- CGGTCAGTCCTCTGTATACT -3'
Posted On 2022-06-15