Incidental Mutation 'R9449:Bcat2'
ID 714131
Institutional Source Beutler Lab
Gene Symbol Bcat2
Ensembl Gene ENSMUSG00000030826
Gene Name branched chain aminotransferase 2, mitochondrial
Synonyms Eca40, Bcat-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock # R9449 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 45570153-45589711 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45585556 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 226 (V226A)
Ref Sequence ENSEMBL: ENSMUSP00000033098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033098] [ENSMUST00000120864] [ENSMUST00000209204] [ENSMUST00000210811] [ENSMUST00000211173]
AlphaFold O35855
Predicted Effect possibly damaging
Transcript: ENSMUST00000033098
AA Change: V226A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033098
Gene: ENSMUSG00000030826
AA Change: V226A

DomainStartEndE-ValueType
Pfam:Aminotran_4 101 351 5.4e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120864
AA Change: V221A

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113045
Gene: ENSMUSG00000030826
AA Change: V221A

DomainStartEndE-ValueType
Pfam:Aminotran_4 119 370 7.6e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209204
AA Change: V186A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000210811
Predicted Effect possibly damaging
Transcript: ENSMUST00000211173
AA Change: V186A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a branched chain aminotransferase found in mitochondria. The encoded protein forms a dimer that catalyzes the first step in the production of the branched chain amino acids leucine, isoleucine, and valine. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: The metabolism of branched chain amino acid is impaired in homozygous null mice, resulting in a phenotype similar to human maple syrup urine disease. Mutants exhibit a failure to thrive and die prematurely, though the severity of the symptoms can be ameliorated with a restricted diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Aarsd1 A C 11: 101,410,771 S262A probably benign Het
Abhd17c A G 7: 84,114,429 Y189H probably damaging Het
Adam33 T C 2: 131,053,686 R570G possibly damaging Het
Alpk2 G A 18: 65,291,393 R1441W probably damaging Het
Arhgap21 A G 2: 20,880,653 V581A probably benign Het
Cdh10 A G 15: 19,013,435 N707S possibly damaging Het
Chd9 T C 8: 90,932,546 F45L unknown Het
Clec1a T C 6: 129,451,643 T25A probably benign Het
Cps1 T C 1: 67,220,512 F1338L probably damaging Het
Cthrc1 A G 15: 39,084,473 T196A probably benign Het
Ctsm A T 13: 61,538,485 V228D probably damaging Het
Dennd3 A T 15: 73,557,628 D920V probably damaging Het
Dnah17 A G 11: 118,096,626 I1286T probably benign Het
Dnah3 T A 7: 119,952,250 T2949S probably benign Het
Dram1 C T 10: 88,356,841 V28M probably benign Het
Eml5 A G 12: 98,861,295 Y559H probably damaging Het
Ermard C T 17: 15,053,292 R380C possibly damaging Het
Fam181a A G 12: 103,315,848 D4G probably damaging Het
Gabrd C A 4: 155,388,346 V127L probably damaging Het
Galnt12 T A 4: 47,104,163 Y140* probably null Het
Gpr161 A T 1: 165,318,820 K442* probably null Het
Haus6 A T 4: 86,595,428 N332K probably benign Het
Igsf3 T A 3: 101,451,006 Y738N probably damaging Het
Itsn1 T A 16: 91,828,376 *622R probably null Het
Kcna2 T A 3: 107,105,571 Y489* probably null Het
Limk1 A G 5: 134,673,010 probably null Het
Manba A T 3: 135,549,318 D479V probably benign Het
Myh6 A T 14: 54,952,322 I1089N possibly damaging Het
Npas4 T A 19: 4,988,464 D142V probably damaging Het
Nr4a1 T C 15: 101,270,172 F30L probably benign Het
Numbl C T 7: 27,276,902 R336C Het
Olfr248 G A 1: 174,391,176 A36T probably benign Het
Olfr481 T C 7: 108,080,833 I13T Het
Parp9 T C 16: 35,956,864 S393P probably damaging Het
Pcdha11 A G 18: 37,012,431 E525G probably damaging Het
Pdia2 T C 17: 26,197,200 T298A probably benign Het
Per3 G A 4: 151,010,488 T946I probably benign Het
Pla2r1 A T 2: 60,428,558 V1162D probably damaging Het
Plxnd1 T A 6: 115,955,769 N1917Y probably damaging Het
Pole3 A T 4: 62,524,040 D114E unknown Het
Ppil3 T C 1: 58,431,238 D151G probably benign Het
Psd3 A T 8: 67,713,181 M365K unknown Het
Psme2b T G 11: 48,945,739 H127P probably damaging Het
Ric8a C G 7: 140,857,480 R4G probably benign Het
Rock2 A T 12: 16,977,762 D1360V probably damaging Het
Simc1 A G 13: 54,526,379 T847A probably benign Het
Slc12a1 T A 2: 125,186,224 V480E probably damaging Het
Slc32a1 T C 2: 158,614,321 F299L probably benign Het
Slc44a2 A G 9: 21,347,037 Y500C Het
Ssbp2 A G 13: 91,675,038 D192G probably benign Het
Stat5b T C 11: 100,790,848 K527E probably benign Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Usp50 A G 2: 126,777,897 probably null Het
Vegfc A T 8: 54,157,018 M70L probably benign Het
Vmn1r40 A G 6: 89,714,872 T224A probably benign Het
Vmn2r116 A G 17: 23,386,945 D277G probably benign Het
Vti1a T A 19: 55,623,846 I197N possibly damaging Het
Zfyve9 C A 4: 108,719,238 L215F probably damaging Het
Znrf3 A T 11: 5,338,710 Y19* probably null Het
Other mutations in Bcat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Bcat2 APN 7 45588260 missense probably damaging 0.97
IGL02383:Bcat2 APN 7 45588007 missense probably damaging 1.00
IGL03157:Bcat2 APN 7 45575498 missense probably benign
IGL03226:Bcat2 APN 7 45588354 missense probably damaging 1.00
prematurely UTSW 7 45588022 critical splice donor site probably null
P0022:Bcat2 UTSW 7 45588345 missense probably damaging 1.00
R1251:Bcat2 UTSW 7 45575986 missense probably damaging 1.00
R1940:Bcat2 UTSW 7 45588368 missense possibly damaging 0.76
R5446:Bcat2 UTSW 7 45585145 missense possibly damaging 0.88
R6243:Bcat2 UTSW 7 45588267 missense probably benign 0.19
R6932:Bcat2 UTSW 7 45589321 missense probably damaging 0.98
R7336:Bcat2 UTSW 7 45575485 missense probably benign 0.00
R7434:Bcat2 UTSW 7 45576005 splice site probably null
R7645:Bcat2 UTSW 7 45587963 missense probably benign 0.04
R7732:Bcat2 UTSW 7 45585193 missense possibly damaging 0.65
R7736:Bcat2 UTSW 7 45585193 missense possibly damaging 0.65
R8140:Bcat2 UTSW 7 45588351 missense probably damaging 1.00
R8474:Bcat2 UTSW 7 45587651 missense probably damaging 1.00
R8782:Bcat2 UTSW 7 45585493 missense probably benign
R9112:Bcat2 UTSW 7 45588022 critical splice donor site probably null
R9320:Bcat2 UTSW 7 45585118 missense probably damaging 0.97
R9365:Bcat2 UTSW 7 45575870 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCTAGAGCTCTGGGTATAAG -3'
(R):5'- TGTCAGGCACCAGGGATGAC -3'

Sequencing Primer
(F):5'- AGCTGAAGTGAGGACCCCTTG -3'
(R):5'- CACCAGGGATGACAAAGGACAC -3'
Posted On 2022-06-15