Incidental Mutation 'R9449:Dnah17'
ID 714145
Institutional Source Beutler Lab
Gene Symbol Dnah17
Ensembl Gene ENSMUSG00000033987
Gene Name dynein, axonemal, heavy chain 17
Synonyms Dnahcl1, LOC382552, 2810003K23Rik, Dnahc17
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9449 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 117912549-118021460 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 117987452 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1286 (I1286T)
Ref Sequence ENSEMBL: ENSMUSP00000101915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084803] [ENSMUST00000106308] [ENSMUST00000132685]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000084803
AA Change: I1286T

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000081864
Gene: ENSMUSG00000033987
AA Change: I1286T

DomainStartEndE-ValueType
Pfam:DHC_N1 183 766 8.5e-142 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1260 1673 5.8e-135 PFAM
Pfam:AAA_6 1793 2023 6e-161 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 7.8e-13 PFAM
Pfam:AAA_7 2400 2671 1.1e-171 PFAM
Pfam:AAA_8 2748 3015 4.9e-166 PFAM
Pfam:MT 3027 3370 3.4e-214 PFAM
Pfam:AAA_9 3388 3615 2.4e-144 PFAM
Pfam:Dynein_heavy 3742 4452 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106308
AA Change: I1286T

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101915
Gene: ENSMUSG00000033987
AA Change: I1286T

DomainStartEndE-ValueType
Pfam:DHC_N1 184 764 1.7e-152 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1262 1671 4.1e-132 PFAM
Pfam:AAA_6 1793 2023 7e-149 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 2.5e-11 PFAM
Pfam:AAA_7 2400 2671 4.4e-169 PFAM
Pfam:AAA_8 2748 3015 7.1e-163 PFAM
Pfam:MT 3027 3370 1.1e-210 PFAM
Pfam:AAA_9 3392 3614 1e-84 PFAM
Pfam:Dynein_heavy 3748 4479 3.5e-230 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000120542
Gene: ENSMUSG00000033987
AA Change: I1290T

DomainStartEndE-ValueType
Pfam:DHC_N2 279 688 3.1e-132 PFAM
Pfam:AAA_6 811 1041 5.3e-149 PFAM
low complexity region 1110 1122 N/A INTRINSIC
Blast:AAA 1123 1354 1e-104 BLAST
Pfam:AAA_7 1452 1671 8.9e-134 PFAM
Pfam:AAA_8 1763 2030 5.4e-163 PFAM
Pfam:MT 2042 2168 6.8e-52 PFAM
Pfam:MT 2163 2412 8.2e-149 PFAM
Pfam:AAA_9 2434 2656 7.9e-85 PFAM
Pfam:Dynein_heavy 2790 3457 2.6e-209 PFAM
Pfam:Dynein_heavy 3460 3569 4.6e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. DNAH17 is a heavy chain associated with axonemal dynein (Milisav and Affara, 1998 [PubMed 9545504]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Aarsd1 A C 11: 101,301,597 (GRCm39) S262A probably benign Het
Abhd17c A G 7: 83,763,637 (GRCm39) Y189H probably damaging Het
Adam33 T C 2: 130,895,606 (GRCm39) R570G possibly damaging Het
Alpk2 G A 18: 65,424,464 (GRCm39) R1441W probably damaging Het
Arhgap21 A G 2: 20,885,464 (GRCm39) V581A probably benign Het
Bcat2 T C 7: 45,234,980 (GRCm39) V226A possibly damaging Het
Cdh10 A G 15: 19,013,521 (GRCm39) N707S possibly damaging Het
Chd9 T C 8: 91,659,174 (GRCm39) F45L unknown Het
Clec1a T C 6: 129,428,606 (GRCm39) T25A probably benign Het
Cps1 T C 1: 67,259,671 (GRCm39) F1338L probably damaging Het
Cthrc1 A G 15: 38,947,868 (GRCm39) T196A probably benign Het
Ctsm A T 13: 61,686,299 (GRCm39) V228D probably damaging Het
Dennd3 A T 15: 73,429,477 (GRCm39) D920V probably damaging Het
Dnah3 T A 7: 119,551,473 (GRCm39) T2949S probably benign Het
Dram1 C T 10: 88,192,703 (GRCm39) V28M probably benign Het
Eml5 A G 12: 98,827,554 (GRCm39) Y559H probably damaging Het
Ermard C T 17: 15,273,554 (GRCm39) R380C possibly damaging Het
Fam181a A G 12: 103,282,107 (GRCm39) D4G probably damaging Het
Gabrd C A 4: 155,472,803 (GRCm39) V127L probably damaging Het
Galnt12 T A 4: 47,104,163 (GRCm39) Y140* probably null Het
Gpr161 A T 1: 165,146,389 (GRCm39) K442* probably null Het
Haus6 A T 4: 86,513,665 (GRCm39) N332K probably benign Het
Igsf3 T A 3: 101,358,322 (GRCm39) Y738N probably damaging Het
Itsn1 T A 16: 91,625,264 (GRCm39) *622R probably null Het
Kcna2 T A 3: 107,012,887 (GRCm39) Y489* probably null Het
Limk1 A G 5: 134,701,864 (GRCm39) probably null Het
Manba A T 3: 135,255,079 (GRCm39) D479V probably benign Het
Myh6 A T 14: 55,189,779 (GRCm39) I1089N possibly damaging Het
Npas4 T A 19: 5,038,492 (GRCm39) D142V probably damaging Het
Nr4a1 T C 15: 101,168,053 (GRCm39) F30L probably benign Het
Numbl C T 7: 26,976,327 (GRCm39) R336C Het
Or10x4 G A 1: 174,218,742 (GRCm39) A36T probably benign Het
Or5p4 T C 7: 107,680,040 (GRCm39) I13T Het
Parp9 T C 16: 35,777,234 (GRCm39) S393P probably damaging Het
Pcdha11 A G 18: 37,145,484 (GRCm39) E525G probably damaging Het
Pdia2 T C 17: 26,416,174 (GRCm39) T298A probably benign Het
Per3 G A 4: 151,094,945 (GRCm39) T946I probably benign Het
Pla2r1 A T 2: 60,258,902 (GRCm39) V1162D probably damaging Het
Plxnd1 T A 6: 115,932,730 (GRCm39) N1917Y probably damaging Het
Pole3 A T 4: 62,442,277 (GRCm39) D114E unknown Het
Ppil3 T C 1: 58,470,397 (GRCm39) D151G probably benign Het
Psd3 A T 8: 68,165,833 (GRCm39) M365K unknown Het
Psme2b T G 11: 48,836,566 (GRCm39) H127P probably damaging Het
Ric8a C G 7: 140,437,393 (GRCm39) R4G probably benign Het
Rock2 A T 12: 17,027,763 (GRCm39) D1360V probably damaging Het
Simc1 A G 13: 54,674,192 (GRCm39) T847A probably benign Het
Slc12a1 T A 2: 125,028,144 (GRCm39) V480E probably damaging Het
Slc32a1 T C 2: 158,456,241 (GRCm39) F299L probably benign Het
Slc44a2 A G 9: 21,258,333 (GRCm39) Y500C Het
Ssbp2 A G 13: 91,823,157 (GRCm39) D192G probably benign Het
Stat5b T C 11: 100,681,674 (GRCm39) K527E probably benign Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Usp50 A G 2: 126,619,817 (GRCm39) probably null Het
Vegfc A T 8: 54,610,053 (GRCm39) M70L probably benign Het
Vmn1r40 A G 6: 89,691,854 (GRCm39) T224A probably benign Het
Vmn2r116 A G 17: 23,605,919 (GRCm39) D277G probably benign Het
Vti1a T A 19: 55,612,278 (GRCm39) I197N possibly damaging Het
Zfyve9 C A 4: 108,576,435 (GRCm39) L215F probably damaging Het
Znrf3 A T 11: 5,288,710 (GRCm39) Y19* probably null Het
Other mutations in Dnah17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Dnah17 APN 11 117,979,040 (GRCm39) missense possibly damaging 0.81
IGL00531:Dnah17 APN 11 117,933,999 (GRCm39) missense probably damaging 0.97
IGL00764:Dnah17 APN 11 117,987,311 (GRCm39) missense probably damaging 0.99
IGL00795:Dnah17 APN 11 117,984,460 (GRCm39) missense probably benign 0.35
IGL00823:Dnah17 APN 11 117,937,987 (GRCm39) missense probably benign 0.22
IGL01145:Dnah17 APN 11 117,937,999 (GRCm39) missense possibly damaging 0.63
IGL01433:Dnah17 APN 11 117,940,760 (GRCm39) missense probably damaging 1.00
IGL01454:Dnah17 APN 11 117,949,223 (GRCm39) missense probably damaging 1.00
IGL01545:Dnah17 APN 11 118,010,394 (GRCm39) missense probably damaging 1.00
IGL01548:Dnah17 APN 11 117,989,438 (GRCm39) missense probably benign 0.21
IGL01557:Dnah17 APN 11 117,964,512 (GRCm39) missense probably damaging 0.98
IGL01632:Dnah17 APN 11 117,924,707 (GRCm39) missense probably damaging 1.00
IGL01636:Dnah17 APN 11 117,931,882 (GRCm39) missense probably benign 0.03
IGL01672:Dnah17 APN 11 117,932,986 (GRCm39) missense probably damaging 0.97
IGL01822:Dnah17 APN 11 117,972,819 (GRCm39) missense probably damaging 1.00
IGL01869:Dnah17 APN 11 117,943,502 (GRCm39) missense probably benign 0.09
IGL01916:Dnah17 APN 11 118,016,114 (GRCm39) missense probably benign 0.00
IGL02131:Dnah17 APN 11 117,963,734 (GRCm39) missense probably damaging 1.00
IGL02154:Dnah17 APN 11 118,015,087 (GRCm39) missense probably benign 0.01
IGL02220:Dnah17 APN 11 117,963,793 (GRCm39) nonsense probably null
IGL02454:Dnah17 APN 11 117,971,593 (GRCm39) missense probably damaging 0.98
IGL02458:Dnah17 APN 11 117,927,176 (GRCm39) missense probably damaging 1.00
IGL02588:Dnah17 APN 11 117,916,479 (GRCm39) missense possibly damaging 0.95
IGL02865:Dnah17 APN 11 117,964,374 (GRCm39) missense probably damaging 1.00
IGL02881:Dnah17 APN 11 117,932,944 (GRCm39) missense probably damaging 1.00
IGL02952:Dnah17 APN 11 117,979,094 (GRCm39) missense probably benign 0.03
IGL03382:Dnah17 APN 11 117,972,769 (GRCm39) missense probably damaging 1.00
IGL03389:Dnah17 APN 11 117,985,805 (GRCm39) missense probably damaging 1.00
ergos UTSW 11 117,931,984 (GRCm39) splice site probably benign
watt UTSW 11 117,971,592 (GRCm39) missense probably damaging 0.96
PIT4280001:Dnah17 UTSW 11 117,989,408 (GRCm39) missense possibly damaging 0.85
R0004:Dnah17 UTSW 11 117,950,918 (GRCm39) missense possibly damaging 0.90
R0112:Dnah17 UTSW 11 117,965,260 (GRCm39) missense possibly damaging 0.82
R0116:Dnah17 UTSW 11 117,949,132 (GRCm39) missense probably benign 0.01
R0157:Dnah17 UTSW 11 118,017,997 (GRCm39) missense probably benign
R0320:Dnah17 UTSW 11 117,943,500 (GRCm39) missense possibly damaging 0.56
R0362:Dnah17 UTSW 11 117,989,365 (GRCm39) missense probably benign 0.10
R0382:Dnah17 UTSW 11 118,019,822 (GRCm39) missense probably damaging 1.00
R0383:Dnah17 UTSW 11 117,958,373 (GRCm39) missense probably benign
R0400:Dnah17 UTSW 11 117,972,904 (GRCm39) missense probably damaging 1.00
R0420:Dnah17 UTSW 11 117,930,765 (GRCm39) missense probably damaging 1.00
R0483:Dnah17 UTSW 11 117,937,950 (GRCm39) missense probably benign
R0533:Dnah17 UTSW 11 118,001,363 (GRCm39) missense possibly damaging 0.50
R0562:Dnah17 UTSW 11 117,963,726 (GRCm39) missense probably damaging 1.00
R0564:Dnah17 UTSW 11 117,973,807 (GRCm39) missense probably damaging 1.00
R0604:Dnah17 UTSW 11 118,012,297 (GRCm39) missense probably benign 0.00
R0608:Dnah17 UTSW 11 117,981,575 (GRCm39) nonsense probably null
R0614:Dnah17 UTSW 11 117,961,394 (GRCm39) splice site probably benign
R0632:Dnah17 UTSW 11 117,958,508 (GRCm39) splice site probably benign
R0831:Dnah17 UTSW 11 117,951,097 (GRCm39) missense probably damaging 0.99
R0838:Dnah17 UTSW 11 117,950,930 (GRCm39) missense probably damaging 1.00
R0879:Dnah17 UTSW 11 117,947,661 (GRCm39) splice site probably benign
R1061:Dnah17 UTSW 11 117,943,514 (GRCm39) missense possibly damaging 0.51
R1190:Dnah17 UTSW 11 117,933,001 (GRCm39) missense probably damaging 1.00
R1293:Dnah17 UTSW 11 118,017,963 (GRCm39) critical splice donor site probably null
R1297:Dnah17 UTSW 11 118,012,192 (GRCm39) splice site probably benign
R1332:Dnah17 UTSW 11 117,934,041 (GRCm39) missense possibly damaging 0.70
R1336:Dnah17 UTSW 11 117,934,041 (GRCm39) missense possibly damaging 0.70
R1364:Dnah17 UTSW 11 118,016,432 (GRCm39) splice site probably benign
R1418:Dnah17 UTSW 11 117,964,849 (GRCm39) missense probably damaging 0.98
R1432:Dnah17 UTSW 11 117,914,153 (GRCm39) missense probably damaging 1.00
R1497:Dnah17 UTSW 11 118,005,059 (GRCm39) missense probably damaging 1.00
R1500:Dnah17 UTSW 11 117,991,879 (GRCm39) missense probably benign
R1506:Dnah17 UTSW 11 118,016,213 (GRCm39) missense possibly damaging 0.53
R1512:Dnah17 UTSW 11 117,985,841 (GRCm39) missense probably benign
R1567:Dnah17 UTSW 11 118,016,811 (GRCm39) missense probably damaging 1.00
R1597:Dnah17 UTSW 11 117,994,324 (GRCm39) splice site probably benign
R1665:Dnah17 UTSW 11 118,012,321 (GRCm39) splice site probably benign
R1703:Dnah17 UTSW 11 117,917,575 (GRCm39) missense probably damaging 1.00
R1716:Dnah17 UTSW 11 117,923,424 (GRCm39) missense probably benign 0.00
R1727:Dnah17 UTSW 11 117,987,362 (GRCm39) nonsense probably null
R1727:Dnah17 UTSW 11 117,961,315 (GRCm39) missense probably damaging 0.98
R1728:Dnah17 UTSW 11 117,960,345 (GRCm39) missense possibly damaging 0.76
R1784:Dnah17 UTSW 11 117,960,345 (GRCm39) missense possibly damaging 0.76
R1852:Dnah17 UTSW 11 118,012,742 (GRCm39) missense probably damaging 0.97
R1869:Dnah17 UTSW 11 117,938,015 (GRCm39) nonsense probably null
R1886:Dnah17 UTSW 11 117,998,987 (GRCm39) missense possibly damaging 0.62
R1893:Dnah17 UTSW 11 117,957,794 (GRCm39) missense probably benign 0.00
R1954:Dnah17 UTSW 11 117,915,557 (GRCm39) missense probably damaging 1.00
R1969:Dnah17 UTSW 11 117,995,361 (GRCm39) missense probably benign 0.00
R1971:Dnah17 UTSW 11 117,995,361 (GRCm39) missense probably benign 0.00
R1975:Dnah17 UTSW 11 117,987,362 (GRCm39) nonsense probably null
R1977:Dnah17 UTSW 11 118,003,417 (GRCm39) missense possibly damaging 0.52
R2055:Dnah17 UTSW 11 117,958,357 (GRCm39) missense probably benign 0.00
R2115:Dnah17 UTSW 11 118,010,628 (GRCm39) missense probably benign 0.00
R2132:Dnah17 UTSW 11 117,924,573 (GRCm39) missense probably damaging 0.98
R2200:Dnah17 UTSW 11 117,993,235 (GRCm39) splice site probably benign
R2277:Dnah17 UTSW 11 117,987,387 (GRCm39) missense possibly damaging 0.81
R2279:Dnah17 UTSW 11 117,987,387 (GRCm39) missense possibly damaging 0.81
R2400:Dnah17 UTSW 11 118,017,210 (GRCm39) critical splice acceptor site probably null
R2402:Dnah17 UTSW 11 118,016,800 (GRCm39) missense probably benign 0.10
R2497:Dnah17 UTSW 11 117,977,850 (GRCm39) splice site probably null
R2923:Dnah17 UTSW 11 117,984,373 (GRCm39) missense probably damaging 1.00
R3121:Dnah17 UTSW 11 117,931,912 (GRCm39) missense probably damaging 1.00
R3236:Dnah17 UTSW 11 117,985,680 (GRCm39) missense probably benign 0.08
R3237:Dnah17 UTSW 11 117,985,680 (GRCm39) missense probably benign 0.08
R3498:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3499:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3746:Dnah17 UTSW 11 117,973,742 (GRCm39) missense probably benign 0.00
R3749:Dnah17 UTSW 11 117,973,742 (GRCm39) missense probably benign 0.00
R3762:Dnah17 UTSW 11 117,995,352 (GRCm39) missense probably benign 0.00
R3826:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R3828:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R3829:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R3877:Dnah17 UTSW 11 117,915,533 (GRCm39) missense probably damaging 1.00
R3899:Dnah17 UTSW 11 117,985,634 (GRCm39) missense possibly damaging 0.78
R3900:Dnah17 UTSW 11 117,985,634 (GRCm39) missense possibly damaging 0.78
R3911:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3913:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3930:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3931:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3969:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R3970:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R4056:Dnah17 UTSW 11 117,961,364 (GRCm39) missense probably benign 0.05
R4113:Dnah17 UTSW 11 118,003,420 (GRCm39) missense possibly damaging 0.50
R4295:Dnah17 UTSW 11 118,009,598 (GRCm39) missense probably damaging 1.00
R4324:Dnah17 UTSW 11 117,985,039 (GRCm39) missense probably benign 0.01
R4412:Dnah17 UTSW 11 117,964,509 (GRCm39) missense probably damaging 1.00
R4413:Dnah17 UTSW 11 117,915,994 (GRCm39) missense probably benign 0.00
R4422:Dnah17 UTSW 11 117,972,799 (GRCm39) missense possibly damaging 0.91
R4552:Dnah17 UTSW 11 117,943,769 (GRCm39) missense possibly damaging 0.79
R4669:Dnah17 UTSW 11 117,965,119 (GRCm39) missense probably benign 0.02
R4677:Dnah17 UTSW 11 118,010,640 (GRCm39) missense probably damaging 1.00
R4716:Dnah17 UTSW 11 117,964,474 (GRCm39) missense probably benign 0.02
R4832:Dnah17 UTSW 11 117,917,606 (GRCm39) missense probably damaging 1.00
R4868:Dnah17 UTSW 11 117,999,038 (GRCm39) missense probably benign 0.03
R4897:Dnah17 UTSW 11 117,969,419 (GRCm39) missense probably damaging 1.00
R4928:Dnah17 UTSW 11 117,918,259 (GRCm39) missense probably damaging 1.00
R4937:Dnah17 UTSW 11 117,932,980 (GRCm39) missense probably damaging 1.00
R4957:Dnah17 UTSW 11 117,965,124 (GRCm39) missense probably benign 0.44
R5008:Dnah17 UTSW 11 118,001,403 (GRCm39) missense probably benign 0.01
R5016:Dnah17 UTSW 11 117,971,592 (GRCm39) missense probably damaging 0.96
R5027:Dnah17 UTSW 11 117,993,365 (GRCm39) missense probably benign 0.01
R5133:Dnah17 UTSW 11 118,007,939 (GRCm39) missense probably benign 0.00
R5140:Dnah17 UTSW 11 117,977,771 (GRCm39) missense probably damaging 1.00
R5146:Dnah17 UTSW 11 118,005,005 (GRCm39) missense probably damaging 0.99
R5151:Dnah17 UTSW 11 117,918,293 (GRCm39) missense probably damaging 1.00
R5153:Dnah17 UTSW 11 117,973,800 (GRCm39) nonsense probably null
R5192:Dnah17 UTSW 11 117,925,185 (GRCm39) missense possibly damaging 0.96
R5315:Dnah17 UTSW 11 118,018,109 (GRCm39) missense possibly damaging 0.79
R5317:Dnah17 UTSW 11 118,018,109 (GRCm39) missense possibly damaging 0.79
R5335:Dnah17 UTSW 11 118,003,340 (GRCm39) missense probably damaging 1.00
R5379:Dnah17 UTSW 11 118,008,029 (GRCm39) intron probably benign
R5396:Dnah17 UTSW 11 118,018,108 (GRCm39) missense probably benign
R5418:Dnah17 UTSW 11 117,985,810 (GRCm39) missense probably benign 0.04
R5534:Dnah17 UTSW 11 117,943,596 (GRCm39) missense possibly damaging 0.83
R5539:Dnah17 UTSW 11 117,964,486 (GRCm39) missense probably benign 0.03
R5594:Dnah17 UTSW 11 117,934,055 (GRCm39) splice site probably null
R5634:Dnah17 UTSW 11 117,943,752 (GRCm39) splice site probably null
R5696:Dnah17 UTSW 11 117,991,882 (GRCm39) missense probably benign 0.44
R5802:Dnah17 UTSW 11 117,927,272 (GRCm39) missense possibly damaging 0.79
R5826:Dnah17 UTSW 11 117,925,193 (GRCm39) missense probably damaging 1.00
R5873:Dnah17 UTSW 11 117,947,723 (GRCm39) missense probably benign 0.01
R5898:Dnah17 UTSW 11 118,005,039 (GRCm39) missense probably benign 0.00
R5934:Dnah17 UTSW 11 117,931,928 (GRCm39) missense probably benign
R6030:Dnah17 UTSW 11 117,916,375 (GRCm39) missense probably benign 0.32
R6030:Dnah17 UTSW 11 117,916,375 (GRCm39) missense probably benign 0.32
R6038:Dnah17 UTSW 11 117,946,715 (GRCm39) missense probably benign 0.00
R6038:Dnah17 UTSW 11 117,946,715 (GRCm39) missense probably benign 0.00
R6113:Dnah17 UTSW 11 118,017,101 (GRCm39) missense probably damaging 1.00
R6117:Dnah17 UTSW 11 118,010,397 (GRCm39) missense probably benign 0.00
R6137:Dnah17 UTSW 11 117,916,480 (GRCm39) missense probably damaging 1.00
R6173:Dnah17 UTSW 11 117,930,772 (GRCm39) missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118,017,150 (GRCm39) missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118,017,148 (GRCm39) missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118,017,149 (GRCm39) nonsense probably null
R6260:Dnah17 UTSW 11 118,017,149 (GRCm39) nonsense probably null
R6260:Dnah17 UTSW 11 118,017,150 (GRCm39) missense probably damaging 1.00
R6260:Dnah17 UTSW 11 118,017,148 (GRCm39) missense probably damaging 1.00
R6278:Dnah17 UTSW 11 118,017,116 (GRCm39) missense probably damaging 0.99
R6298:Dnah17 UTSW 11 117,998,987 (GRCm39) missense probably benign 0.00
R6300:Dnah17 UTSW 11 117,925,136 (GRCm39) missense probably damaging 1.00
R6302:Dnah17 UTSW 11 118,019,981 (GRCm39) missense probably benign 0.09
R6363:Dnah17 UTSW 11 118,001,331 (GRCm39) missense probably benign
R6381:Dnah17 UTSW 11 118,020,011 (GRCm39) missense probably benign 0.08
R6418:Dnah17 UTSW 11 118,020,023 (GRCm39) missense probably damaging 0.99
R6660:Dnah17 UTSW 11 117,991,014 (GRCm39) missense probably benign
R6803:Dnah17 UTSW 11 118,016,198 (GRCm39) missense probably benign 0.00
R6820:Dnah17 UTSW 11 117,959,826 (GRCm39) missense probably damaging 0.99
R6885:Dnah17 UTSW 11 117,981,598 (GRCm39) missense possibly damaging 0.47
R6921:Dnah17 UTSW 11 117,932,310 (GRCm39) missense probably damaging 0.98
R6932:Dnah17 UTSW 11 117,950,905 (GRCm39) missense possibly damaging 0.95
R6954:Dnah17 UTSW 11 117,957,258 (GRCm39) missense probably damaging 1.00
R7000:Dnah17 UTSW 11 117,916,528 (GRCm39) critical splice acceptor site probably null
R7007:Dnah17 UTSW 11 118,009,697 (GRCm39) missense possibly damaging 0.92
R7048:Dnah17 UTSW 11 117,936,944 (GRCm39) missense possibly damaging 0.80
R7056:Dnah17 UTSW 11 118,016,212 (GRCm39) missense probably benign
R7131:Dnah17 UTSW 11 117,970,484 (GRCm39) missense probably benign 0.14
R7143:Dnah17 UTSW 11 117,976,956 (GRCm39) missense probably damaging 1.00
R7146:Dnah17 UTSW 11 117,972,936 (GRCm39) missense probably damaging 0.98
R7147:Dnah17 UTSW 11 117,985,755 (GRCm39) missense probably benign 0.31
R7172:Dnah17 UTSW 11 117,931,957 (GRCm39) nonsense probably null
R7183:Dnah17 UTSW 11 118,020,014 (GRCm39) missense probably benign
R7297:Dnah17 UTSW 11 117,994,182 (GRCm39) missense probably damaging 0.98
R7297:Dnah17 UTSW 11 117,946,556 (GRCm39) critical splice donor site probably null
R7367:Dnah17 UTSW 11 118,006,022 (GRCm39) missense probably benign
R7398:Dnah17 UTSW 11 117,971,550 (GRCm39) missense probably damaging 0.96
R7426:Dnah17 UTSW 11 117,981,543 (GRCm39) missense probably null 0.79
R7524:Dnah17 UTSW 11 118,012,307 (GRCm39) missense probably benign 0.03
R7529:Dnah17 UTSW 11 117,940,692 (GRCm39) critical splice donor site probably null
R7615:Dnah17 UTSW 11 118,001,373 (GRCm39) nonsense probably null
R7681:Dnah17 UTSW 11 117,916,012 (GRCm39) missense probably damaging 1.00
R7702:Dnah17 UTSW 11 118,012,304 (GRCm39) missense possibly damaging 0.64
R7702:Dnah17 UTSW 11 117,916,466 (GRCm39) missense probably benign 0.00
R7713:Dnah17 UTSW 11 117,915,997 (GRCm39) missense probably benign 0.02
R7809:Dnah17 UTSW 11 117,995,462 (GRCm39) missense probably benign 0.09
R7842:Dnah17 UTSW 11 117,970,508 (GRCm39) critical splice acceptor site probably null
R7935:Dnah17 UTSW 11 118,018,048 (GRCm39) missense probably benign 0.20
R7951:Dnah17 UTSW 11 118,009,592 (GRCm39) missense possibly damaging 0.64
R8070:Dnah17 UTSW 11 117,915,497 (GRCm39) missense probably damaging 0.97
R8098:Dnah17 UTSW 11 117,941,193 (GRCm39) missense probably damaging 1.00
R8101:Dnah17 UTSW 11 118,016,744 (GRCm39) missense probably benign
R8177:Dnah17 UTSW 11 118,019,753 (GRCm39) missense possibly damaging 0.60
R8343:Dnah17 UTSW 11 118,005,021 (GRCm39) missense probably benign
R8350:Dnah17 UTSW 11 117,977,873 (GRCm39) missense probably damaging 0.98
R8393:Dnah17 UTSW 11 117,947,855 (GRCm39) missense probably damaging 1.00
R8401:Dnah17 UTSW 11 117,915,485 (GRCm39) missense probably damaging 0.96
R8418:Dnah17 UTSW 11 117,994,284 (GRCm39) missense probably benign 0.01
R8450:Dnah17 UTSW 11 117,977,873 (GRCm39) missense probably damaging 0.98
R8546:Dnah17 UTSW 11 118,015,101 (GRCm39) missense probably benign 0.00
R8697:Dnah17 UTSW 11 117,976,985 (GRCm39) missense possibly damaging 0.96
R8710:Dnah17 UTSW 11 117,932,973 (GRCm39) missense probably damaging 1.00
R8713:Dnah17 UTSW 11 117,979,028 (GRCm39) missense probably damaging 1.00
R8722:Dnah17 UTSW 11 117,961,283 (GRCm39) nonsense probably null
R8797:Dnah17 UTSW 11 117,992,201 (GRCm39) missense probably benign 0.00
R8953:Dnah17 UTSW 11 118,016,238 (GRCm39) splice site probably benign
R8965:Dnah17 UTSW 11 117,915,492 (GRCm39) missense probably damaging 1.00
R8976:Dnah17 UTSW 11 117,917,666 (GRCm39) missense probably damaging 1.00
R9090:Dnah17 UTSW 11 117,931,870 (GRCm39) missense probably damaging 1.00
R9128:Dnah17 UTSW 11 117,937,004 (GRCm39) missense possibly damaging 0.76
R9134:Dnah17 UTSW 11 117,978,972 (GRCm39) missense probably damaging 1.00
R9245:Dnah17 UTSW 11 118,016,503 (GRCm39) missense probably benign 0.02
R9251:Dnah17 UTSW 11 118,012,618 (GRCm39) missense probably benign 0.03
R9271:Dnah17 UTSW 11 117,931,870 (GRCm39) missense probably damaging 1.00
R9367:Dnah17 UTSW 11 118,012,212 (GRCm39) missense possibly damaging 0.93
R9367:Dnah17 UTSW 11 117,987,464 (GRCm39) missense possibly damaging 0.95
R9381:Dnah17 UTSW 11 117,914,219 (GRCm39) missense probably benign
R9405:Dnah17 UTSW 11 118,009,737 (GRCm39) missense probably benign
R9517:Dnah17 UTSW 11 117,915,440 (GRCm39) missense possibly damaging 0.76
R9588:Dnah17 UTSW 11 118,012,783 (GRCm39) missense probably benign 0.00
R9629:Dnah17 UTSW 11 117,979,804 (GRCm39) missense probably damaging 1.00
R9654:Dnah17 UTSW 11 117,927,156 (GRCm39) critical splice donor site probably null
R9655:Dnah17 UTSW 11 117,971,649 (GRCm39) missense possibly damaging 0.94
R9662:Dnah17 UTSW 11 117,925,166 (GRCm39) missense probably damaging 0.97
R9686:Dnah17 UTSW 11 117,979,048 (GRCm39) missense possibly damaging 0.46
R9689:Dnah17 UTSW 11 117,963,731 (GRCm39) missense probably damaging 1.00
R9706:Dnah17 UTSW 11 118,017,026 (GRCm39) missense probably damaging 1.00
X0058:Dnah17 UTSW 11 117,973,751 (GRCm39) missense probably damaging 1.00
Z1176:Dnah17 UTSW 11 118,017,992 (GRCm39) missense probably benign 0.01
Z1177:Dnah17 UTSW 11 117,977,786 (GRCm39) missense probably damaging 1.00
Z1177:Dnah17 UTSW 11 117,969,389 (GRCm39) missense possibly damaging 0.91
Z1177:Dnah17 UTSW 11 118,017,968 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCATGAGCTGTTGCCAGTG -3'
(R):5'- GAGGAATTTGATTTCTGCCCAGC -3'

Sequencing Primer
(F):5'- GTTCTGCAGCTCGCTCACAG -3'
(R):5'- TGATGGAGTTTGTCTTAATGTAACAC -3'
Posted On 2022-06-15