Mutagenetix > Incidental Mutation

Incidental Mutation 'R9449:Eml5'

714147

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.237) question?

Stock #

R9449 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 98861295 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 559 (Y559H)

Ref Sequence

ENSEMBL: ENSMUSP00000152709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

AlphaFold

Q8BQM8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065716
AA Change: Y520H

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: Y520H

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000223282
AA Change: Y559H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002D01Rik	CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	7: 29,247,623		probably benign	Het
Aarsd1	A	C	11: 101,410,771	S262A	probably benign	Het
Abhd17c	A	G	7: 84,114,429	Y189H	probably damaging	Het
Adam33	T	C	2: 131,053,686	R570G	possibly damaging	Het
Alpk2	G	A	18: 65,291,393	R1441W	probably damaging	Het
Arhgap21	A	G	2: 20,880,653	V581A	probably benign	Het
Bcat2	T	C	7: 45,585,556	V226A	possibly damaging	Het
Cdh10	A	G	15: 19,013,435	N707S	possibly damaging	Het
Chd9	T	C	8: 90,932,546	F45L	unknown	Het
Clec1a	T	C	6: 129,451,643	T25A	probably benign	Het
Cps1	T	C	1: 67,220,512	F1338L	probably damaging	Het
Cthrc1	A	G	15: 39,084,473	T196A	probably benign	Het
Ctsm	A	T	13: 61,538,485	V228D	probably damaging	Het
Dennd3	A	T	15: 73,557,628	D920V	probably damaging	Het
Dnah17	A	G	11: 118,096,626	I1286T	probably benign	Het
Dnah3	T	A	7: 119,952,250	T2949S	probably benign	Het
Dram1	C	T	10: 88,356,841	V28M	probably benign	Het
Ermard	C	T	17: 15,053,292	R380C	possibly damaging	Het
Fam181a	A	G	12: 103,315,848	D4G	probably damaging	Het
Gabrd	C	A	4: 155,388,346	V127L	probably damaging	Het
Galnt12	T	A	4: 47,104,163	Y140*	probably null	Het
Gpr161	A	T	1: 165,318,820	K442*	probably null	Het
Haus6	A	T	4: 86,595,428	N332K	probably benign	Het
Igsf3	T	A	3: 101,451,006	Y738N	probably damaging	Het
Itsn1	T	A	16: 91,828,376	*622R	probably null	Het
Kcna2	T	A	3: 107,105,571	Y489*	probably null	Het
Limk1	A	G	5: 134,673,010		probably null	Het
Manba	A	T	3: 135,549,318	D479V	probably benign	Het
Myh6	A	T	14: 54,952,322	I1089N	possibly damaging	Het
Npas4	T	A	19: 4,988,464	D142V	probably damaging	Het
Nr4a1	T	C	15: 101,270,172	F30L	probably benign	Het
Numbl	C	T	7: 27,276,902	R336C		Het
Olfr248	G	A	1: 174,391,176	A36T	probably benign	Het
Olfr481	T	C	7: 108,080,833	I13T		Het
Parp9	T	C	16: 35,956,864	S393P	probably damaging	Het
Pcdha11	A	G	18: 37,012,431	E525G	probably damaging	Het
Pdia2	T	C	17: 26,197,200	T298A	probably benign	Het
Per3	G	A	4: 151,010,488	T946I	probably benign	Het
Pla2r1	A	T	2: 60,428,558	V1162D	probably damaging	Het
Plxnd1	T	A	6: 115,955,769	N1917Y	probably damaging	Het
Pole3	A	T	4: 62,524,040	D114E	unknown	Het
Ppil3	T	C	1: 58,431,238	D151G	probably benign	Het
Psd3	A	T	8: 67,713,181	M365K	unknown	Het
Psme2b	T	G	11: 48,945,739	H127P	probably damaging	Het
Ric8a	C	G	7: 140,857,480	R4G	probably benign	Het
Rock2	A	T	12: 16,977,762	D1360V	probably damaging	Het
Simc1	A	G	13: 54,526,379	T847A	probably benign	Het
Slc12a1	T	A	2: 125,186,224	V480E	probably damaging	Het
Slc32a1	T	C	2: 158,614,321	F299L	probably benign	Het
Slc44a2	A	G	9: 21,347,037	Y500C		Het
Ssbp2	A	G	13: 91,675,038	D192G	probably benign	Het
Stat5b	T	C	11: 100,790,848	K527E	probably benign	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Usp50	A	G	2: 126,777,897		probably null	Het
Vegfc	A	T	8: 54,157,018	M70L	probably benign	Het
Vmn1r40	A	G	6: 89,714,872	T224A	probably benign	Het
Vmn2r116	A	G	17: 23,386,945	D277G	probably benign	Het
Vti1a	T	A	19: 55,623,846	I197N	possibly damaging	Het
Zfyve9	C	A	4: 108,719,238	L215F	probably damaging	Het
Znrf3	A	T	11: 5,338,710	Y19*	probably null	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
R8732:Eml5	UTSW	12	98815959	missense	probably damaging	0.99
R8956:Eml5	UTSW	12	98852693	missense	possibly damaging	0.69
R8975:Eml5	UTSW	12	98810570	missense	probably damaging	0.99
R9131:Eml5	UTSW	12	98858840	missense	probably damaging	1.00
R9258:Eml5	UTSW	12	98844117	missense	possibly damaging	0.77
R9261:Eml5	UTSW	12	98856028	missense	probably damaging	0.99
R9276:Eml5	UTSW	12	98798801	missense	probably damaging	0.99
R9301:Eml5	UTSW	12	98882033	nonsense	probably null
R9368:Eml5	UTSW	12	98796578	missense	probably benign	0.31
R9392:Eml5	UTSW	12	98900940	missense	probably damaging	1.00
R9393:Eml5	UTSW	12	98876174	missense	probably benign	0.35
R9570:Eml5	UTSW	12	98815984	missense	probably benign	0.15
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GAAGCTTCAATGGTAAAAGTGCTAG -3'
(R):5'- GAGAAATATACCCCTCAGTTCATTC -3'

Sequencing Primer
(F):5'- TGGTAAAAGTGCTAGTTTGGAAC -3'
(R):5'- AATATACCCCTCAGTTCATTCATTTC -3'

Posted On

2022-06-15