Incidental Mutation 'R9449:Vmn2r116'
ID 714160
Institutional Source Beutler Lab
Gene Symbol Vmn2r116
Ensembl Gene ENSMUSG00000090966
Gene Name vomeronasal 2, receptor 116
Synonyms V2Rp5, EG619697
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R9449 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 23384803-23401864 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23386945 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 277 (D277G)
Ref Sequence ENSEMBL: ENSMUSP00000128106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164856]
AlphaFold E9Q6I0
Predicted Effect probably benign
Transcript: ENSMUST00000164856
AA Change: D277G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: D277G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.4e-30 PFAM
Pfam:NCD3G 511 564 1.2e-22 PFAM
low complexity region 589 594 N/A INTRINSIC
Pfam:7tm_3 595 832 8.7e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Aarsd1 A C 11: 101,410,771 S262A probably benign Het
Abhd17c A G 7: 84,114,429 Y189H probably damaging Het
Adam33 T C 2: 131,053,686 R570G possibly damaging Het
Alpk2 G A 18: 65,291,393 R1441W probably damaging Het
Arhgap21 A G 2: 20,880,653 V581A probably benign Het
Bcat2 T C 7: 45,585,556 V226A possibly damaging Het
Cdh10 A G 15: 19,013,435 N707S possibly damaging Het
Chd9 T C 8: 90,932,546 F45L unknown Het
Clec1a T C 6: 129,451,643 T25A probably benign Het
Cps1 T C 1: 67,220,512 F1338L probably damaging Het
Cthrc1 A G 15: 39,084,473 T196A probably benign Het
Ctsm A T 13: 61,538,485 V228D probably damaging Het
Dennd3 A T 15: 73,557,628 D920V probably damaging Het
Dnah17 A G 11: 118,096,626 I1286T probably benign Het
Dnah3 T A 7: 119,952,250 T2949S probably benign Het
Dram1 C T 10: 88,356,841 V28M probably benign Het
Eml5 A G 12: 98,861,295 Y559H probably damaging Het
Ermard C T 17: 15,053,292 R380C possibly damaging Het
Fam181a A G 12: 103,315,848 D4G probably damaging Het
Gabrd C A 4: 155,388,346 V127L probably damaging Het
Galnt12 T A 4: 47,104,163 Y140* probably null Het
Gpr161 A T 1: 165,318,820 K442* probably null Het
Haus6 A T 4: 86,595,428 N332K probably benign Het
Igsf3 T A 3: 101,451,006 Y738N probably damaging Het
Itsn1 T A 16: 91,828,376 *622R probably null Het
Kcna2 T A 3: 107,105,571 Y489* probably null Het
Limk1 A G 5: 134,673,010 probably null Het
Manba A T 3: 135,549,318 D479V probably benign Het
Myh6 A T 14: 54,952,322 I1089N possibly damaging Het
Npas4 T A 19: 4,988,464 D142V probably damaging Het
Nr4a1 T C 15: 101,270,172 F30L probably benign Het
Numbl C T 7: 27,276,902 R336C Het
Olfr248 G A 1: 174,391,176 A36T probably benign Het
Olfr481 T C 7: 108,080,833 I13T Het
Parp9 T C 16: 35,956,864 S393P probably damaging Het
Pcdha11 A G 18: 37,012,431 E525G probably damaging Het
Pdia2 T C 17: 26,197,200 T298A probably benign Het
Per3 G A 4: 151,010,488 T946I probably benign Het
Pla2r1 A T 2: 60,428,558 V1162D probably damaging Het
Plxnd1 T A 6: 115,955,769 N1917Y probably damaging Het
Pole3 A T 4: 62,524,040 D114E unknown Het
Ppil3 T C 1: 58,431,238 D151G probably benign Het
Psd3 A T 8: 67,713,181 M365K unknown Het
Psme2b T G 11: 48,945,739 H127P probably damaging Het
Ric8a C G 7: 140,857,480 R4G probably benign Het
Rock2 A T 12: 16,977,762 D1360V probably damaging Het
Simc1 A G 13: 54,526,379 T847A probably benign Het
Slc12a1 T A 2: 125,186,224 V480E probably damaging Het
Slc32a1 T C 2: 158,614,321 F299L probably benign Het
Slc44a2 A G 9: 21,347,037 Y500C Het
Ssbp2 A G 13: 91,675,038 D192G probably benign Het
Stat5b T C 11: 100,790,848 K527E probably benign Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Usp50 A G 2: 126,777,897 probably null Het
Vegfc A T 8: 54,157,018 M70L probably benign Het
Vmn1r40 A G 6: 89,714,872 T224A probably benign Het
Vti1a T A 19: 55,623,846 I197N possibly damaging Het
Zfyve9 C A 4: 108,719,238 L215F probably damaging Het
Znrf3 A T 11: 5,338,710 Y19* probably null Het
Other mutations in Vmn2r116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Vmn2r116 APN 17 23385995 missense possibly damaging 0.94
IGL00985:Vmn2r116 APN 17 23401515 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23397727 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23387236 missense probably benign 0.12
IGL01383:Vmn2r116 APN 17 23401601 missense probably damaging 1.00
IGL01459:Vmn2r116 APN 17 23384929 missense probably damaging 1.00
IGL01725:Vmn2r116 APN 17 23386645 missense probably damaging 1.00
IGL02125:Vmn2r116 APN 17 23397627 splice site probably benign
IGL02170:Vmn2r116 APN 17 23384933 missense probably benign
IGL02209:Vmn2r116 APN 17 23388787 missense probably damaging 1.00
IGL02226:Vmn2r116 APN 17 23384834 missense probably null
IGL02272:Vmn2r116 APN 17 23385999 missense probably benign 0.06
IGL02272:Vmn2r116 APN 17 23386004 missense probably damaging 1.00
IGL02403:Vmn2r116 APN 17 23387364 missense probably damaging 1.00
IGL02686:Vmn2r116 APN 17 23388793 missense probably damaging 0.99
IGL02750:Vmn2r116 APN 17 23397634 splice site probably benign
IGL02977:Vmn2r116 APN 17 23388774 missense possibly damaging 0.90
PIT4449001:Vmn2r116 UTSW 17 23388947 missense probably benign 0.41
R0015:Vmn2r116 UTSW 17 23401849 missense probably benign 0.03
R0219:Vmn2r116 UTSW 17 23386098 nonsense probably null
R0281:Vmn2r116 UTSW 17 23401413 missense possibly damaging 0.90
R0415:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
R0592:Vmn2r116 UTSW 17 23386915 missense probably damaging 0.99
R0610:Vmn2r116 UTSW 17 23387312 missense probably damaging 1.00
R0635:Vmn2r116 UTSW 17 23386887 missense possibly damaging 0.95
R0843:Vmn2r116 UTSW 17 23400960 missense probably benign 0.01
R1329:Vmn2r116 UTSW 17 23387188 missense possibly damaging 0.89
R1396:Vmn2r116 UTSW 17 23386141 missense probably benign
R1401:Vmn2r116 UTSW 17 23386596 splice site probably benign
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1766:Vmn2r116 UTSW 17 23401766 missense probably damaging 0.98
R2157:Vmn2r116 UTSW 17 23401469 missense probably damaging 1.00
R3622:Vmn2r116 UTSW 17 23386051 missense probably benign 0.11
R3690:Vmn2r116 UTSW 17 23384824 missense unknown
R4298:Vmn2r116 UTSW 17 23401827 missense possibly damaging 0.69
R4373:Vmn2r116 UTSW 17 23401421 missense probably benign 0.01
R4860:Vmn2r116 UTSW 17 23401803 missense probably benign
R4941:Vmn2r116 UTSW 17 23401142 missense probably damaging 1.00
R5119:Vmn2r116 UTSW 17 23387164 missense probably benign 0.01
R5503:Vmn2r116 UTSW 17 23386804 missense probably benign 0.07
R5510:Vmn2r116 UTSW 17 23386121 missense probably damaging 1.00
R5538:Vmn2r116 UTSW 17 23401067 missense probably benign 0.00
R5689:Vmn2r116 UTSW 17 23397719 missense probably benign 0.30
R5765:Vmn2r116 UTSW 17 23401404 missense probably damaging 0.99
R5794:Vmn2r116 UTSW 17 23385968 missense probably damaging 0.99
R5807:Vmn2r116 UTSW 17 23387307 missense probably damaging 1.00
R5837:Vmn2r116 UTSW 17 23387080 missense probably damaging 1.00
R6262:Vmn2r116 UTSW 17 23387377 missense probably benign 0.03
R6298:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R6651:Vmn2r116 UTSW 17 23388831 nonsense probably null
R6667:Vmn2r116 UTSW 17 23401092 missense probably damaging 1.00
R7393:Vmn2r116 UTSW 17 23386125 missense probably benign 0.14
R7571:Vmn2r116 UTSW 17 23384856 splice site probably null
R7940:Vmn2r116 UTSW 17 23386972 missense probably damaging 0.99
R8510:Vmn2r116 UTSW 17 23385931 nonsense probably null
R8950:Vmn2r116 UTSW 17 23401493 missense probably damaging 1.00
R8956:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R8977:Vmn2r116 UTSW 17 23386942 missense possibly damaging 0.56
R9030:Vmn2r116 UTSW 17 23384890 missense possibly damaging 0.82
R9077:Vmn2r116 UTSW 17 23385982 missense probably benign 0.14
R9223:Vmn2r116 UTSW 17 23401167 missense probably damaging 1.00
R9401:Vmn2r116 UTSW 17 23401592 missense probably damaging 1.00
S24628:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
Z1176:Vmn2r116 UTSW 17 23401428 missense probably damaging 1.00
Z1177:Vmn2r116 UTSW 17 23388892 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGTTGGTCATCTCAGACAG -3'
(R):5'- GCATTTGACAGAGTTCAATGTCTG -3'

Sequencing Primer
(F):5'- GTTGGTCATCTCAGACAGTGATCAAG -3'
(R):5'- GTCTGGACAAAATGTTTAAACCCAG -3'
Posted On 2022-06-15