Incidental Mutation 'R9450:Hecw2'
ID 714166
Institutional Source Beutler Lab
Gene Symbol Hecw2
Ensembl Gene ENSMUSG00000042807
Gene Name HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Synonyms A730039N16Rik, Nedl2, D030049F17Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock # R9450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 53806876-54195168 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 53839029 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1339 (Y1339*)
Ref Sequence ENSEMBL: ENSMUSP00000084942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087659] [ENSMUST00000120904]
AlphaFold Q6I6G8
Predicted Effect probably null
Transcript: ENSMUST00000087659
AA Change: Y1339*
SMART Domains Protein: ENSMUSP00000084942
Gene: ENSMUSG00000042807
AA Change: Y1339*

DomainStartEndE-ValueType
Pfam:HECW_N 45 164 4.6e-62 PFAM
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120904
AA Change: Y1339*
SMART Domains Protein: ENSMUSP00000113283
Gene: ENSMUSG00000042807
AA Change: Y1339*

DomainStartEndE-ValueType
PDB:2LFE|A 42 162 6e-80 PDB
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of E3 ubiquitin ligases which plays an important role in the proliferation, migration and differentiation of neural crest cells as a regulator of glial cell line-derived neurotrophic factor (GDNF)/Ret signaling. This gene also plays an important role in angiogenesis through stabilization of endothelial cell-to-cell junctions as a regulator of angiomotin-like 1 stability. The encoded protein contains an N-terminal calcium/lipid-binding (C2) domain involved in membrane targeting, two-four WW domains responsible for cellular localization and substrate recognition, and a C-terminal homologous with E6-associated protein C-terminus (HECT) catalytic domain. Naturally occurring mutations in this gene are associated with neurodevelopmental delay, hypotonia, and epilepsy. The decreased expression of this gene in the aganglionic colon is associated with Hirschsprung's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
2810004N23Rik T C 8: 124,840,476 K229E probably damaging Het
4931409K22Rik T A 5: 24,549,449 I395F probably benign Het
9030624J02Rik T C 7: 118,752,895 probably null Het
Abca8b T C 11: 109,969,104 T523A probably damaging Het
Adamts18 G T 8: 113,764,310 D508E probably benign Het
Arap2 T C 5: 62,698,419 E558G probably benign Het
Arid4a A T 12: 71,072,600 D331V Het
Ash1l A T 3: 89,007,832 K1923M possibly damaging Het
Atad2b T A 12: 5,013,859 S947T probably benign Het
B4galt1 A T 4: 40,853,804 M1K probably null Het
BC025446 T A 15: 75,220,725 C98S probably damaging Het
Ccpg1 G A 9: 72,997,421 S4N unknown Het
Cfap43 A T 19: 47,897,871 L102M probably benign Het
Clic6 T C 16: 92,530,756 I483T possibly damaging Het
Col6a6 A T 9: 105,784,174 D245E probably benign Het
Cpsf7 G A 19: 10,540,849 probably null Het
Depdc5 A G 5: 32,934,010 D721G probably benign Het
Dhx29 C T 13: 112,947,328 T639I possibly damaging Het
Dock7 T C 4: 98,973,189 E1397G unknown Het
Dsp C T 13: 38,192,403 T1388M probably damaging Het
Fam186b C T 15: 99,285,544 G73D probably damaging Het
Ganab A G 19: 8,915,712 D960G probably damaging Het
Gm12394 G T 4: 42,793,833 Q100K probably benign Het
Gria1 T C 11: 57,309,789 V764A probably damaging Het
Grk3 T C 5: 112,915,047 K645E probably benign Het
Hmcn2 C A 2: 31,426,833 T3808N probably damaging Het
Il20rb A T 9: 100,473,002 N129K possibly damaging Het
Itgb4 T C 11: 115,983,271 Y340H probably damaging Het
Itgb6 T C 2: 60,628,028 I460M probably benign Het
Kat14 T C 2: 144,400,819 I599T possibly damaging Het
Kif1b A C 4: 149,238,010 D817E probably benign Het
Lamb2 T A 9: 108,480,561 C94* probably null Het
Larp1 T C 11: 58,051,064 S743P probably damaging Het
Ldlrap1 T C 4: 134,747,179 N267S probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Ltf T C 9: 111,021,996 L92P probably damaging Het
Mns1 C A 9: 72,452,608 Q347K probably benign Het
Myof A T 19: 37,960,926 F611I probably damaging Het
Nop56 T C 2: 130,275,681 L76P probably damaging Het
Nphp1 T C 2: 127,774,088 H114R Het
Olfr1280 T A 2: 111,316,053 N191K probably benign Het
Olfr1512 G C 14: 52,372,653 Y133* probably null Het
Olfr390 C A 11: 73,787,275 N112K possibly damaging Het
Park2 C A 17: 11,838,634 H301N possibly damaging Het
Pcdha12 A G 18: 37,020,939 D237G probably damaging Het
Pitpnm3 A T 11: 72,061,586 M593K possibly damaging Het
Plxdc1 C T 11: 97,954,855 V211I probably damaging Het
Prpf38a A T 4: 108,572,875 H143Q probably damaging Het
Sdk2 T C 11: 113,806,279 T1769A probably benign Het
Stab1 T C 14: 31,162,939 D153G possibly damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tnrc6b T A 15: 80,880,436 M713K probably benign Het
Top2a T C 11: 99,003,608 K966E possibly damaging Het
Vars2 T C 17: 35,662,135 T421A probably damaging Het
Vmn1r1 A T 1: 182,157,205 C298* probably null Het
Vwa3a T C 7: 120,804,030 probably null Het
Vwa5b1 G T 4: 138,588,629 Q601K possibly damaging Het
Zbtb46 T C 2: 181,395,488 K454E probably damaging Het
Zfp426 T C 9: 20,470,281 H470R probably benign Het
Other mutations in Hecw2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Hecw2 APN 1 53830737 missense probably damaging 1.00
IGL00338:Hecw2 APN 1 53827881 splice site probably benign
IGL00530:Hecw2 APN 1 53853280 missense probably damaging 1.00
IGL01343:Hecw2 APN 1 53826976 missense probably damaging 0.96
IGL01503:Hecw2 APN 1 53826961 missense probably damaging 1.00
IGL01989:Hecw2 APN 1 53840792 missense probably damaging 1.00
IGL02016:Hecw2 APN 1 53831543 missense possibly damaging 0.73
IGL02052:Hecw2 APN 1 53926511 missense probably benign
IGL02085:Hecw2 APN 1 53942802 critical splice acceptor site probably null
IGL02302:Hecw2 APN 1 53933248 missense probably damaging 1.00
IGL02310:Hecw2 APN 1 53923916 missense probably null 0.38
IGL02388:Hecw2 APN 1 53925699 missense probably benign 0.17
IGL02499:Hecw2 APN 1 53926488 missense probably benign
IGL02695:Hecw2 APN 1 53926209 missense possibly damaging 0.94
IGL02732:Hecw2 APN 1 53926688 splice site probably benign
IGL03100:Hecw2 APN 1 53831656 missense probably damaging 1.00
IGL03175:Hecw2 APN 1 53926257 missense possibly damaging 0.51
IGL03253:Hecw2 APN 1 53832716 missense possibly damaging 0.85
IGL03356:Hecw2 APN 1 53927058 splice site probably benign
Memoriam UTSW 1 53926056 missense probably benign
recollect UTSW 1 53904422 missense possibly damaging 0.88
ANU74:Hecw2 UTSW 1 53925694 missense probably benign 0.01
R0077:Hecw2 UTSW 1 53868831 splice site probably benign
R0133:Hecw2 UTSW 1 53830740 missense probably damaging 1.00
R0268:Hecw2 UTSW 1 53926698 splice site probably benign
R1303:Hecw2 UTSW 1 54040393 missense probably benign 0.00
R1460:Hecw2 UTSW 1 53813245 missense probably damaging 0.96
R1524:Hecw2 UTSW 1 53851618 missense probably damaging 1.00
R1533:Hecw2 UTSW 1 53926545 splice site probably null
R1828:Hecw2 UTSW 1 53926023 missense probably benign
R2170:Hecw2 UTSW 1 53942797 missense probably damaging 0.99
R2338:Hecw2 UTSW 1 53904422 missense possibly damaging 0.88
R3016:Hecw2 UTSW 1 53830680 missense probably damaging 1.00
R3872:Hecw2 UTSW 1 53832757 splice site probably benign
R3892:Hecw2 UTSW 1 53926121 missense probably benign 0.01
R4086:Hecw2 UTSW 1 53831656 missense probably damaging 1.00
R4247:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4248:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4249:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4545:Hecw2 UTSW 1 53813222 makesense probably null
R4805:Hecw2 UTSW 1 53840859 missense probably damaging 1.00
R4834:Hecw2 UTSW 1 53830752 missense probably damaging 1.00
R4884:Hecw2 UTSW 1 53950841 missense probably benign 0.03
R4983:Hecw2 UTSW 1 53832671 missense probably benign 0.42
R5168:Hecw2 UTSW 1 53913300 missense probably damaging 1.00
R5482:Hecw2 UTSW 1 53926201 missense probably benign 0.09
R5549:Hecw2 UTSW 1 53925691 missense possibly damaging 0.91
R5623:Hecw2 UTSW 1 53832623 missense probably null 1.00
R5740:Hecw2 UTSW 1 53887603 missense probably benign 0.12
R5919:Hecw2 UTSW 1 53937090 missense probably damaging 0.99
R6058:Hecw2 UTSW 1 53923976 missense possibly damaging 0.67
R6460:Hecw2 UTSW 1 53868833 splice site probably null
R6875:Hecw2 UTSW 1 53937132 missense probably benign 0.01
R7097:Hecw2 UTSW 1 53865124 missense possibly damaging 0.88
R7131:Hecw2 UTSW 1 53865121 missense probably damaging 1.00
R7291:Hecw2 UTSW 1 53914594 missense probably damaging 1.00
R7401:Hecw2 UTSW 1 53904343 missense probably damaging 1.00
R7482:Hecw2 UTSW 1 54040470 missense probably damaging 0.99
R7501:Hecw2 UTSW 1 53913872 critical splice acceptor site probably null
R7520:Hecw2 UTSW 1 53926056 missense probably benign
R7611:Hecw2 UTSW 1 53913300 missense probably damaging 1.00
R8184:Hecw2 UTSW 1 54040387 missense probably benign 0.37
R8286:Hecw2 UTSW 1 53840769 missense probably damaging 1.00
R8300:Hecw2 UTSW 1 53887616 missense probably null 0.07
R8354:Hecw2 UTSW 1 53925308 critical splice donor site probably null
R8362:Hecw2 UTSW 1 54040491 start codon destroyed probably null 0.51
R8691:Hecw2 UTSW 1 53865064 missense probably benign 0.26
R8745:Hecw2 UTSW 1 53933171 missense probably damaging 1.00
R8769:Hecw2 UTSW 1 53913348 missense probably benign 0.00
R8830:Hecw2 UTSW 1 53891146 missense probably damaging 1.00
R8842:Hecw2 UTSW 1 53950874 missense
R8874:Hecw2 UTSW 1 53904449 splice site probably benign
R9064:Hecw2 UTSW 1 53826886 missense probably benign 0.08
R9326:Hecw2 UTSW 1 54040210 missense probably damaging 1.00
R9486:Hecw2 UTSW 1 53813307 missense probably damaging 1.00
Z1177:Hecw2 UTSW 1 53923943 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGTAAGCCTGAAGCATGAC -3'
(R):5'- AGCAGATTTCCTCCACAAGTC -3'

Sequencing Primer
(F):5'- GCCTGAAGCATGACAACTATATTTG -3'
(R):5'- TGGCTAATGAAGACACACACTATAG -3'
Posted On 2022-06-15