Mutagenetix > Incidental Mutation

Incidental Mutation 'R9450:Hecw2'

714166

Institutional Source

Beutler Lab

Gene Symbol

Hecw2

Ensembl Gene

ENSMUSG00000042807

Gene Name

HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2

Synonyms

A730039N16Rik, Nedl2, D030049F17Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.296) question?

Stock #

R9450 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53806876-54195168 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 53839029 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 1339 (Y1339*)

Ref Sequence

ENSEMBL: ENSMUSP00000084942 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087659] [ENSMUST00000120904]

AlphaFold

Q6I6G8

Predicted Effect

probably null
Transcript: ENSMUST00000087659
AA Change: Y1339*

SMART Domains

Protein: ENSMUSP00000084942
Gene: ENSMUSG00000042807
AA Change: Y1339*

Domain	Start	End	E-Value	Type
Pfam:HECW_N	45	164	4.6e-62	PFAM
low complexity region	165	178	N/A	INTRINSIC
C2	186	297	2.19e-12	SMART
low complexity region	577	596	N/A	INTRINSIC
low complexity region	716	735	N/A	INTRINSIC
low complexity region	746	755	N/A	INTRINSIC
low complexity region	769	786	N/A	INTRINSIC
WW	814	846	1.21e-11	SMART
coiled coil region	853	880	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
WW	992	1024	2.12e-7	SMART
Blast:HECTc	1111	1183	2e-23	BLAST
HECTc	1241	1578	8.02e-183	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000120904
AA Change: Y1339*

SMART Domains

Protein: ENSMUSP00000113283
Gene: ENSMUSG00000042807
AA Change: Y1339*

Domain	Start	End	E-Value	Type
PDB:2LFE\|A	42	162	6e-80	PDB
low complexity region	165	178	N/A	INTRINSIC
C2	186	297	2.19e-12	SMART
low complexity region	577	596	N/A	INTRINSIC
low complexity region	716	735	N/A	INTRINSIC
low complexity region	746	755	N/A	INTRINSIC
low complexity region	769	786	N/A	INTRINSIC
WW	814	846	1.21e-11	SMART
coiled coil region	853	880	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
WW	992	1024	2.12e-7	SMART
Blast:HECTc	1111	1183	2e-23	BLAST
HECTc	1241	1578	8.02e-183	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of E3 ubiquitin ligases which plays an important role in the proliferation, migration and differentiation of neural crest cells as a regulator of glial cell line-derived neurotrophic factor (GDNF)/Ret signaling. This gene also plays an important role in angiogenesis through stabilization of endothelial cell-to-cell junctions as a regulator of angiomotin-like 1 stability. The encoded protein contains an N-terminal calcium/lipid-binding (C2) domain involved in membrane targeting, two-four WW domains responsible for cellular localization and substrate recognition, and a C-terminal homologous with E6-associated protein C-terminus (HECT) catalytic domain. Naturally occurring mutations in this gene are associated with neurodevelopmental delay, hypotonia, and epilepsy. The decreased expression of this gene in the aganglionic colon is associated with Hirschsprung's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007K13Rik	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	2: 28,466,110		probably benign	Het
2200002D01Rik	CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	7: 29,247,623		probably benign	Het
2810004N23Rik	T	C	8: 124,840,476	K229E	probably damaging	Het
4931409K22Rik	T	A	5: 24,549,449	I395F	probably benign	Het
9030624J02Rik	T	C	7: 118,752,895		probably null	Het
Abca8b	T	C	11: 109,969,104	T523A	probably damaging	Het
Adamts18	G	T	8: 113,764,310	D508E	probably benign	Het
Arap2	T	C	5: 62,698,419	E558G	probably benign	Het
Arid4a	A	T	12: 71,072,600	D331V		Het
Ash1l	A	T	3: 89,007,832	K1923M	possibly damaging	Het
Atad2b	T	A	12: 5,013,859	S947T	probably benign	Het
B4galt1	A	T	4: 40,853,804	M1K	probably null	Het
BC025446	T	A	15: 75,220,725	C98S	probably damaging	Het
Ccpg1	G	A	9: 72,997,421	S4N	unknown	Het
Cfap43	A	T	19: 47,897,871	L102M	probably benign	Het
Clic6	T	C	16: 92,530,756	I483T	possibly damaging	Het
Col6a6	A	T	9: 105,784,174	D245E	probably benign	Het
Cpsf7	G	A	19: 10,540,849		probably null	Het
Depdc5	A	G	5: 32,934,010	D721G	probably benign	Het
Dhx29	C	T	13: 112,947,328	T639I	possibly damaging	Het
Dock7	T	C	4: 98,973,189	E1397G	unknown	Het
Dsp	C	T	13: 38,192,403	T1388M	probably damaging	Het
Fam186b	C	T	15: 99,285,544	G73D	probably damaging	Het
Ganab	A	G	19: 8,915,712	D960G	probably damaging	Het
Gm12394	G	T	4: 42,793,833	Q100K	probably benign	Het
Gria1	T	C	11: 57,309,789	V764A	probably damaging	Het
Grk3	T	C	5: 112,915,047	K645E	probably benign	Het
Hmcn2	C	A	2: 31,426,833	T3808N	probably damaging	Het
Il20rb	A	T	9: 100,473,002	N129K	possibly damaging	Het
Itgb4	T	C	11: 115,983,271	Y340H	probably damaging	Het
Itgb6	T	C	2: 60,628,028	I460M	probably benign	Het
Kat14	T	C	2: 144,400,819	I599T	possibly damaging	Het
Kif1b	A	C	4: 149,238,010	D817E	probably benign	Het
Lamb2	T	A	9: 108,480,561	C94*	probably null	Het
Larp1	T	C	11: 58,051,064	S743P	probably damaging	Het
Ldlrap1	T	C	4: 134,747,179	N267S	probably damaging	Het
Ltbp2	G	A	12: 84,791,090	P1192L	probably benign	Het
Ltf	T	C	9: 111,021,996	L92P	probably damaging	Het
Mns1	C	A	9: 72,452,608	Q347K	probably benign	Het
Myof	A	T	19: 37,960,926	F611I	probably damaging	Het
Nop56	T	C	2: 130,275,681	L76P	probably damaging	Het
Nphp1	T	C	2: 127,774,088	H114R		Het
Olfr1280	T	A	2: 111,316,053	N191K	probably benign	Het
Olfr1512	G	C	14: 52,372,653	Y133*	probably null	Het
Olfr390	C	A	11: 73,787,275	N112K	possibly damaging	Het
Park2	C	A	17: 11,838,634	H301N	possibly damaging	Het
Pcdha12	A	G	18: 37,020,939	D237G	probably damaging	Het
Pitpnm3	A	T	11: 72,061,586	M593K	possibly damaging	Het
Plxdc1	C	T	11: 97,954,855	V211I	probably damaging	Het
Prpf38a	A	T	4: 108,572,875	H143Q	probably damaging	Het
Sdk2	T	C	11: 113,806,279	T1769A	probably benign	Het
Stab1	T	C	14: 31,162,939	D153G	possibly damaging	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Tnrc6b	T	A	15: 80,880,436	M713K	probably benign	Het
Top2a	T	C	11: 99,003,608	K966E	possibly damaging	Het
Vars2	T	C	17: 35,662,135	T421A	probably damaging	Het
Vmn1r1	A	T	1: 182,157,205	C298*	probably null	Het
Vwa3a	T	C	7: 120,804,030		probably null	Het
Vwa5b1	G	T	4: 138,588,629	Q601K	possibly damaging	Het
Zbtb46	T	C	2: 181,395,488	K454E	probably damaging	Het
Zfp426	T	C	9: 20,470,281	H470R	probably benign	Het

Other mutations in Hecw2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Hecw2	APN	1	53830737	missense	probably damaging	1.00
IGL00338:Hecw2	APN	1	53827881	splice site	probably benign
IGL00530:Hecw2	APN	1	53853280	missense	probably damaging	1.00
IGL01343:Hecw2	APN	1	53826976	missense	probably damaging	0.96
IGL01503:Hecw2	APN	1	53826961	missense	probably damaging	1.00
IGL01989:Hecw2	APN	1	53840792	missense	probably damaging	1.00
IGL02016:Hecw2	APN	1	53831543	missense	possibly damaging	0.73
IGL02052:Hecw2	APN	1	53926511	missense	probably benign
IGL02085:Hecw2	APN	1	53942802	critical splice acceptor site	probably null
IGL02302:Hecw2	APN	1	53933248	missense	probably damaging	1.00
IGL02310:Hecw2	APN	1	53923916	missense	probably null	0.38
IGL02388:Hecw2	APN	1	53925699	missense	probably benign	0.17
IGL02499:Hecw2	APN	1	53926488	missense	probably benign
IGL02695:Hecw2	APN	1	53926209	missense	possibly damaging	0.94
IGL02732:Hecw2	APN	1	53926688	splice site	probably benign
IGL03100:Hecw2	APN	1	53831656	missense	probably damaging	1.00
IGL03175:Hecw2	APN	1	53926257	missense	possibly damaging	0.51
IGL03253:Hecw2	APN	1	53832716	missense	possibly damaging	0.85
IGL03356:Hecw2	APN	1	53927058	splice site	probably benign
Memoriam	UTSW	1	53926056	missense	probably benign
recollect	UTSW	1	53904422	missense	possibly damaging	0.88
ANU74:Hecw2	UTSW	1	53925694	missense	probably benign	0.01
R0077:Hecw2	UTSW	1	53868831	splice site	probably benign
R0133:Hecw2	UTSW	1	53830740	missense	probably damaging	1.00
R0268:Hecw2	UTSW	1	53926698	splice site	probably benign
R1303:Hecw2	UTSW	1	54040393	missense	probably benign	0.00
R1460:Hecw2	UTSW	1	53813245	missense	probably damaging	0.96
R1524:Hecw2	UTSW	1	53851618	missense	probably damaging	1.00
R1533:Hecw2	UTSW	1	53926545	splice site	probably null
R1828:Hecw2	UTSW	1	53926023	missense	probably benign
R2170:Hecw2	UTSW	1	53942797	missense	probably damaging	0.99
R2338:Hecw2	UTSW	1	53904422	missense	possibly damaging	0.88
R3016:Hecw2	UTSW	1	53830680	missense	probably damaging	1.00
R3872:Hecw2	UTSW	1	53832757	splice site	probably benign
R3892:Hecw2	UTSW	1	53926121	missense	probably benign	0.01
R4086:Hecw2	UTSW	1	53831656	missense	probably damaging	1.00
R4247:Hecw2	UTSW	1	53832645	missense	probably damaging	1.00
R4248:Hecw2	UTSW	1	53832645	missense	probably damaging	1.00
R4249:Hecw2	UTSW	1	53832645	missense	probably damaging	1.00
R4545:Hecw2	UTSW	1	53813222	makesense	probably null
R4805:Hecw2	UTSW	1	53840859	missense	probably damaging	1.00
R4834:Hecw2	UTSW	1	53830752	missense	probably damaging	1.00
R4884:Hecw2	UTSW	1	53950841	missense	probably benign	0.03
R4983:Hecw2	UTSW	1	53832671	missense	probably benign	0.42
R5168:Hecw2	UTSW	1	53913300	missense	probably damaging	1.00
R5482:Hecw2	UTSW	1	53926201	missense	probably benign	0.09
R5549:Hecw2	UTSW	1	53925691	missense	possibly damaging	0.91
R5623:Hecw2	UTSW	1	53832623	missense	probably null	1.00
R5740:Hecw2	UTSW	1	53887603	missense	probably benign	0.12
R5919:Hecw2	UTSW	1	53937090	missense	probably damaging	0.99
R6058:Hecw2	UTSW	1	53923976	missense	possibly damaging	0.67
R6460:Hecw2	UTSW	1	53868833	splice site	probably null
R6875:Hecw2	UTSW	1	53937132	missense	probably benign	0.01
R7097:Hecw2	UTSW	1	53865124	missense	possibly damaging	0.88
R7131:Hecw2	UTSW	1	53865121	missense	probably damaging	1.00
R7291:Hecw2	UTSW	1	53914594	missense	probably damaging	1.00
R7401:Hecw2	UTSW	1	53904343	missense	probably damaging	1.00
R7482:Hecw2	UTSW	1	54040470	missense	probably damaging	0.99
R7501:Hecw2	UTSW	1	53913872	critical splice acceptor site	probably null
R7520:Hecw2	UTSW	1	53926056	missense	probably benign
R7611:Hecw2	UTSW	1	53913300	missense	probably damaging	1.00
R8184:Hecw2	UTSW	1	54040387	missense	probably benign	0.37
R8286:Hecw2	UTSW	1	53840769	missense	probably damaging	1.00
R8300:Hecw2	UTSW	1	53887616	missense	probably null	0.07
R8354:Hecw2	UTSW	1	53925308	critical splice donor site	probably null
R8362:Hecw2	UTSW	1	54040491	start codon destroyed	probably null	0.51
R8691:Hecw2	UTSW	1	53865064	missense	probably benign	0.26
R8745:Hecw2	UTSW	1	53933171	missense	probably damaging	1.00
R8769:Hecw2	UTSW	1	53913348	missense	probably benign	0.00
R8830:Hecw2	UTSW	1	53891146	missense	probably damaging	1.00
R8842:Hecw2	UTSW	1	53950874	missense
R8874:Hecw2	UTSW	1	53904449	splice site	probably benign
R9064:Hecw2	UTSW	1	53826886	missense	probably benign	0.08
R9326:Hecw2	UTSW	1	54040210	missense	probably damaging	1.00
R9486:Hecw2	UTSW	1	53813307	missense	probably damaging	1.00
R9763:Hecw2	UTSW	1	53923915	missense	probably damaging	1.00
R9766:Hecw2	UTSW	1	53865128	missense	probably damaging	1.00
Z1177:Hecw2	UTSW	1	53923943	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- AGGTAAGCCTGAAGCATGAC -3'
(R):5'- AGCAGATTTCCTCCACAAGTC -3'

Sequencing Primer
(F):5'- GCCTGAAGCATGACAACTATATTTG -3'
(R):5'- TGGCTAATGAAGACACACACTATAG -3'

Posted On

2022-06-15