Incidental Mutation 'R9450:Itgb6'
ID 714170
Institutional Source Beutler Lab
Gene Symbol Itgb6
Ensembl Gene ENSMUSG00000026971
Gene Name integrin beta 6
Synonyms 4831415H04Rik, 2210409C20Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.818) question?
Stock # R9450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 60598292-60722643 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 60628028 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 460 (I460M)
Ref Sequence ENSEMBL: ENSMUSP00000028348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028348] [ENSMUST00000059888] [ENSMUST00000112517] [ENSMUST00000154764]
AlphaFold Q9Z0T9
Predicted Effect probably benign
Transcript: ENSMUST00000028348
AA Change: I460M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028348
Gene: ENSMUSG00000026971
AA Change: I460M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.59e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 776 7.82e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059888
AA Change: I460M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054944
Gene: ENSMUSG00000026971
AA Change: I460M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.59e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 776 7.82e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112517
AA Change: I460M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108136
Gene: ENSMUSG00000026971
AA Change: I460M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.81e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 759 2.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154764
AA Change: I460M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117815
Gene: ENSMUSG00000026971
AA Change: I460M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.62e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 755 2.3e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the integrin superfamily. Members of this family are adhesion receptors that function in signaling from the extracellular matrix to the cell. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. The encoded protein forms a dimer with an alpha v chain and this heterodimer can bind to ligands like fibronectin and transforming growth factor beta 1. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit baldness associated with macrophage infiltration of skin, exaggerated pulmonary inflammation, and an impaired mucosal mast cell response to nematode infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
2810004N23Rik T C 8: 124,840,476 K229E probably damaging Het
4931409K22Rik T A 5: 24,549,449 I395F probably benign Het
9030624J02Rik T C 7: 118,752,895 probably null Het
Abca8b T C 11: 109,969,104 T523A probably damaging Het
Adamts18 G T 8: 113,764,310 D508E probably benign Het
Arap2 T C 5: 62,698,419 E558G probably benign Het
Arid4a A T 12: 71,072,600 D331V Het
Ash1l A T 3: 89,007,832 K1923M possibly damaging Het
Atad2b T A 12: 5,013,859 S947T probably benign Het
B4galt1 A T 4: 40,853,804 M1K probably null Het
BC025446 T A 15: 75,220,725 C98S probably damaging Het
Ccpg1 G A 9: 72,997,421 S4N unknown Het
Cfap43 A T 19: 47,897,871 L102M probably benign Het
Clic6 T C 16: 92,530,756 I483T possibly damaging Het
Col6a6 A T 9: 105,784,174 D245E probably benign Het
Cpsf7 G A 19: 10,540,849 probably null Het
Depdc5 A G 5: 32,934,010 D721G probably benign Het
Dhx29 C T 13: 112,947,328 T639I possibly damaging Het
Dock7 T C 4: 98,973,189 E1397G unknown Het
Dsp C T 13: 38,192,403 T1388M probably damaging Het
Fam186b C T 15: 99,285,544 G73D probably damaging Het
Ganab A G 19: 8,915,712 D960G probably damaging Het
Gm12394 G T 4: 42,793,833 Q100K probably benign Het
Gria1 T C 11: 57,309,789 V764A probably damaging Het
Grk3 T C 5: 112,915,047 K645E probably benign Het
Hecw2 A T 1: 53,839,029 Y1339* probably null Het
Hmcn2 C A 2: 31,426,833 T3808N probably damaging Het
Il20rb A T 9: 100,473,002 N129K possibly damaging Het
Itgb4 T C 11: 115,983,271 Y340H probably damaging Het
Kat14 T C 2: 144,400,819 I599T possibly damaging Het
Kif1b A C 4: 149,238,010 D817E probably benign Het
Lamb2 T A 9: 108,480,561 C94* probably null Het
Larp1 T C 11: 58,051,064 S743P probably damaging Het
Ldlrap1 T C 4: 134,747,179 N267S probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Ltf T C 9: 111,021,996 L92P probably damaging Het
Mns1 C A 9: 72,452,608 Q347K probably benign Het
Myof A T 19: 37,960,926 F611I probably damaging Het
Nop56 T C 2: 130,275,681 L76P probably damaging Het
Nphp1 T C 2: 127,774,088 H114R Het
Olfr1280 T A 2: 111,316,053 N191K probably benign Het
Olfr1512 G C 14: 52,372,653 Y133* probably null Het
Olfr390 C A 11: 73,787,275 N112K possibly damaging Het
Park2 C A 17: 11,838,634 H301N possibly damaging Het
Pcdha12 A G 18: 37,020,939 D237G probably damaging Het
Pitpnm3 A T 11: 72,061,586 M593K possibly damaging Het
Plxdc1 C T 11: 97,954,855 V211I probably damaging Het
Prpf38a A T 4: 108,572,875 H143Q probably damaging Het
Sdk2 T C 11: 113,806,279 T1769A probably benign Het
Stab1 T C 14: 31,162,939 D153G possibly damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tnrc6b T A 15: 80,880,436 M713K probably benign Het
Top2a T C 11: 99,003,608 K966E possibly damaging Het
Vars2 T C 17: 35,662,135 T421A probably damaging Het
Vmn1r1 A T 1: 182,157,205 C298* probably null Het
Vwa3a T C 7: 120,804,030 probably null Het
Vwa5b1 G T 4: 138,588,629 Q601K possibly damaging Het
Zbtb46 T C 2: 181,395,488 K454E probably damaging Het
Zfp426 T C 9: 20,470,281 H470R probably benign Het
Other mutations in Itgb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Itgb6 APN 2 60620352 missense probably benign 0.07
IGL01363:Itgb6 APN 2 60611382 missense possibly damaging 0.89
IGL01810:Itgb6 APN 2 60627985 missense probably benign 0.19
IGL02026:Itgb6 APN 2 60628066 missense possibly damaging 0.79
IGL02347:Itgb6 APN 2 60611412 missense probably benign
R0372:Itgb6 UTSW 2 60627841 missense probably benign 0.28
R0533:Itgb6 UTSW 2 60669197 missense probably benign 0.22
R0542:Itgb6 UTSW 2 60605136 missense possibly damaging 0.53
R1037:Itgb6 UTSW 2 60650068 missense probably damaging 1.00
R1191:Itgb6 UTSW 2 60653137 splice site probably null
R1775:Itgb6 UTSW 2 60672644 nonsense probably null
R1802:Itgb6 UTSW 2 60653281 missense probably benign 0.22
R1934:Itgb6 UTSW 2 60669149 missense probably benign 0.05
R2847:Itgb6 UTSW 2 60600535 missense probably damaging 1.00
R3934:Itgb6 UTSW 2 60611411 missense possibly damaging 0.89
R5603:Itgb6 UTSW 2 60620362 missense probably benign 0.03
R6255:Itgb6 UTSW 2 60605276 missense probably damaging 1.00
R6571:Itgb6 UTSW 2 60628456 missense probably damaging 1.00
R6908:Itgb6 UTSW 2 60650021 missense probably benign 0.02
R7010:Itgb6 UTSW 2 60649978 missense probably damaging 1.00
R7212:Itgb6 UTSW 2 60634654 missense probably damaging 0.99
R7259:Itgb6 UTSW 2 60650011 missense probably damaging 1.00
R7300:Itgb6 UTSW 2 60605306 missense probably benign 0.04
R7491:Itgb6 UTSW 2 60620376 missense probably damaging 1.00
R7532:Itgb6 UTSW 2 60669213 missense probably benign
R7861:Itgb6 UTSW 2 60628444 missense probably damaging 1.00
R8086:Itgb6 UTSW 2 60650032 missense probably damaging 0.98
R8795:Itgb6 UTSW 2 60653285 missense probably damaging 1.00
R8886:Itgb6 UTSW 2 60627980 nonsense probably null
R8933:Itgb6 UTSW 2 60627903 missense probably damaging 1.00
R9015:Itgb6 UTSW 2 60654688 missense probably damaging 1.00
X0018:Itgb6 UTSW 2 60672666 missense possibly damaging 0.88
Z1088:Itgb6 UTSW 2 60620211 missense probably null 1.00
Z1176:Itgb6 UTSW 2 60611468 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCTTCCGTACGGCGATAAG -3'
(R):5'- CTGCAGGTTGCTGGATAGAG -3'

Sequencing Primer
(F):5'- GCGATAAGTGGCAGATGCAC -3'
(R):5'- GAGGAAGCAATAACCAGCATTTTC -3'
Posted On 2022-06-15