Incidental Mutation 'R9450:Nop56'
ID 714173
Institutional Source Beutler Lab
Gene Symbol Nop56
Ensembl Gene ENSMUSG00000027405
Gene Name NOP56 ribonucleoprotein
Synonyms NOP56, Nol5a, 2310044F10Rik, 56kDa with KKE/D repeat
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock # R9450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 130274430-130279313 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130275681 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 76 (L76P)
Ref Sequence ENSEMBL: ENSMUSP00000099487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028890] [ENSMUST00000028892] [ENSMUST00000103198] [ENSMUST00000136621] [ENSMUST00000159373] [ENSMUST00000184538]
AlphaFold Q9D6Z1
Predicted Effect probably benign
Transcript: ENSMUST00000028890
SMART Domains Protein: ENSMUSP00000028890
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Nop 44 127 1.1e-26 PFAM
coiled coil region 131 176 N/A INTRINSIC
low complexity region 185 204 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
low complexity region 242 264 N/A INTRINSIC
low complexity region 280 292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028892
SMART Domains Protein: ENSMUSP00000028892
Gene: ENSMUSG00000027406

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
Iso_dh 49 375 1.43e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103198
AA Change: L76P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099487
Gene: ENSMUSG00000027405
AA Change: L76P

DomainStartEndE-ValueType
Pfam:NOP5NT 5 70 4.3e-20 PFAM
NOSIC 167 219 1.18e-30 SMART
internal_repeat_1 257 305 4.06e-5 PROSPERO
coiled coil region 415 460 N/A INTRINSIC
low complexity region 469 488 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
low complexity region 564 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136621
AA Change: L76P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124616
Gene: ENSMUSG00000027405
AA Change: L76P

DomainStartEndE-ValueType
Pfam:NOP5NT 4 70 3.6e-22 PFAM
NOSIC 167 219 1.18e-30 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000125305
Gene: ENSMUSG00000027405
AA Change: L84P

DomainStartEndE-ValueType
Pfam:NOP5NT 14 79 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143547
Predicted Effect probably benign
Transcript: ENSMUST00000146454
SMART Domains Protein: ENSMUSP00000125304
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:Nop 1 152 7.8e-66 PFAM
coiled coil region 159 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149955
SMART Domains Protein: ENSMUSP00000123879
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
NOSIC 2 35 1.24e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150401
SMART Domains Protein: ENSMUSP00000123890
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:Nop 26 103 3.9e-26 PFAM
coiled coil region 110 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159373
SMART Domains Protein: ENSMUSP00000124080
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:Nop 10 94 6e-28 PFAM
coiled coil region 98 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184538
SMART Domains Protein: ENSMUSP00000139331
Gene: ENSMUSG00000027406

DomainStartEndE-ValueType
Pfam:Iso_dh 6 71 1.8e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nop56p is a yeast nucleolar protein that is part of a complex with the nucleolar proteins Nop58p and fibrillarin. Nop56p is required for assembly of the 60S ribosomal subunit and is involved in pre-rRNA processing. The protein encoded by this gene is similar in sequence to Nop56p and is also found in the nucleolus. Expansion of a GGCCTG repeat from 3-8 copies to 1500-2500 copies in an intron of this gene results in spinocerebellar ataxia 36. Multiple transcript variants encoding several different isoforms have been found for this gene, but the full-length nature of most of them has not been determined. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
2810004N23Rik T C 8: 124,840,476 K229E probably damaging Het
4931409K22Rik T A 5: 24,549,449 I395F probably benign Het
9030624J02Rik T C 7: 118,752,895 probably null Het
Abca8b T C 11: 109,969,104 T523A probably damaging Het
Adamts18 G T 8: 113,764,310 D508E probably benign Het
Arap2 T C 5: 62,698,419 E558G probably benign Het
Arid4a A T 12: 71,072,600 D331V Het
Ash1l A T 3: 89,007,832 K1923M possibly damaging Het
Atad2b T A 12: 5,013,859 S947T probably benign Het
B4galt1 A T 4: 40,853,804 M1K probably null Het
BC025446 T A 15: 75,220,725 C98S probably damaging Het
Ccpg1 G A 9: 72,997,421 S4N unknown Het
Cfap43 A T 19: 47,897,871 L102M probably benign Het
Clic6 T C 16: 92,530,756 I483T possibly damaging Het
Col6a6 A T 9: 105,784,174 D245E probably benign Het
Cpsf7 G A 19: 10,540,849 probably null Het
Depdc5 A G 5: 32,934,010 D721G probably benign Het
Dhx29 C T 13: 112,947,328 T639I possibly damaging Het
Dock7 T C 4: 98,973,189 E1397G unknown Het
Dsp C T 13: 38,192,403 T1388M probably damaging Het
Fam186b C T 15: 99,285,544 G73D probably damaging Het
Ganab A G 19: 8,915,712 D960G probably damaging Het
Gm12394 G T 4: 42,793,833 Q100K probably benign Het
Gria1 T C 11: 57,309,789 V764A probably damaging Het
Grk3 T C 5: 112,915,047 K645E probably benign Het
Hecw2 A T 1: 53,839,029 Y1339* probably null Het
Hmcn2 C A 2: 31,426,833 T3808N probably damaging Het
Il20rb A T 9: 100,473,002 N129K possibly damaging Het
Itgb4 T C 11: 115,983,271 Y340H probably damaging Het
Itgb6 T C 2: 60,628,028 I460M probably benign Het
Kat14 T C 2: 144,400,819 I599T possibly damaging Het
Kif1b A C 4: 149,238,010 D817E probably benign Het
Lamb2 T A 9: 108,480,561 C94* probably null Het
Larp1 T C 11: 58,051,064 S743P probably damaging Het
Ldlrap1 T C 4: 134,747,179 N267S probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Ltf T C 9: 111,021,996 L92P probably damaging Het
Mns1 C A 9: 72,452,608 Q347K probably benign Het
Myof A T 19: 37,960,926 F611I probably damaging Het
Nphp1 T C 2: 127,774,088 H114R Het
Olfr1280 T A 2: 111,316,053 N191K probably benign Het
Olfr1512 G C 14: 52,372,653 Y133* probably null Het
Olfr390 C A 11: 73,787,275 N112K possibly damaging Het
Park2 C A 17: 11,838,634 H301N possibly damaging Het
Pcdha12 A G 18: 37,020,939 D237G probably damaging Het
Pitpnm3 A T 11: 72,061,586 M593K possibly damaging Het
Plxdc1 C T 11: 97,954,855 V211I probably damaging Het
Prpf38a A T 4: 108,572,875 H143Q probably damaging Het
Sdk2 T C 11: 113,806,279 T1769A probably benign Het
Stab1 T C 14: 31,162,939 D153G possibly damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tnrc6b T A 15: 80,880,436 M713K probably benign Het
Top2a T C 11: 99,003,608 K966E possibly damaging Het
Vars2 T C 17: 35,662,135 T421A probably damaging Het
Vmn1r1 A T 1: 182,157,205 C298* probably null Het
Vwa3a T C 7: 120,804,030 probably null Het
Vwa5b1 G T 4: 138,588,629 Q601K possibly damaging Het
Zbtb46 T C 2: 181,395,488 K454E probably damaging Het
Zfp426 T C 9: 20,470,281 H470R probably benign Het
Other mutations in Nop56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Nop56 APN 2 130275995 missense possibly damaging 0.77
IGL02330:Nop56 APN 2 130276766 missense probably damaging 0.99
IGL02939:Nop56 APN 2 130278197 missense probably damaging 1.00
IGL03149:Nop56 APN 2 130277525 missense probably damaging 1.00
bookish UTSW 2 130276772 missense possibly damaging 0.96
escholar UTSW 2 130277887 missense probably damaging 1.00
scholar UTSW 2 130275982 missense probably damaging 1.00
IGL03046:Nop56 UTSW 2 130275569 unclassified probably benign
R0421:Nop56 UTSW 2 130276772 missense possibly damaging 0.96
R1405:Nop56 UTSW 2 130277948 missense probably benign 0.22
R1405:Nop56 UTSW 2 130277948 missense probably benign 0.22
R1713:Nop56 UTSW 2 130277966 missense possibly damaging 0.85
R2202:Nop56 UTSW 2 130277568 missense probably damaging 1.00
R2203:Nop56 UTSW 2 130277568 missense probably damaging 1.00
R2204:Nop56 UTSW 2 130277568 missense probably damaging 1.00
R3697:Nop56 UTSW 2 130277587 missense probably damaging 1.00
R4114:Nop56 UTSW 2 130276673 splice site probably null
R4679:Nop56 UTSW 2 130278273 missense probably benign 0.36
R4788:Nop56 UTSW 2 130278900 missense probably benign 0.05
R4792:Nop56 UTSW 2 130277864 missense possibly damaging 0.96
R4999:Nop56 UTSW 2 130275725 missense probably benign 0.00
R5889:Nop56 UTSW 2 130275982 missense probably damaging 1.00
R6016:Nop56 UTSW 2 130276625 critical splice donor site probably null
R6389:Nop56 UTSW 2 130277887 missense probably damaging 1.00
R7025:Nop56 UTSW 2 130277881 nonsense probably null
R7393:Nop56 UTSW 2 130274638 missense probably benign 0.06
R7867:Nop56 UTSW 2 130278285 missense possibly damaging 0.53
R8026:Nop56 UTSW 2 130277268 missense probably benign
R8886:Nop56 UTSW 2 130275982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGGCTTTGCAATGATGAC -3'
(R):5'- TGGAAATGCAGACGAACTCC -3'

Sequencing Primer
(F):5'- ACTTATATATCTGTCAATCCCCTGAG -3'
(R):5'- GGGACTTTAAGAATAGATCCTCCAG -3'
Posted On 2022-06-15