Incidental Mutation 'R9450:Kat14'
ID 714174
Institutional Source Beutler Lab
Gene Symbol Kat14
Ensembl Gene ENSMUSG00000027425
Gene Name lysine acetyltransferase 14
Synonyms D2Wsu131e, 2510008M08Rik, ATAC2, Csrp2bp, D2Ertd473e
Accession Numbers

Genbank: NM_181417; MGI: 1917264

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 144368983-144407676 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144400819 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 599 (I599T)
Ref Sequence ENSEMBL: ENSMUSP00000028911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028911] [ENSMUST00000147747]
AlphaFold Q8CID0
Predicted Effect possibly damaging
Transcript: ENSMUST00000028911
AA Change: I599T

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028911
Gene: ENSMUSG00000027425
AA Change: I599T

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
low complexity region 310 334 N/A INTRINSIC
Pfam:Acetyltransf_10 640 748 7e-12 PFAM
Pfam:Acetyltransf_7 670 750 5.8e-12 PFAM
Pfam:Acetyltransf_1 675 749 7.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125398
SMART Domains Protein: ENSMUSP00000129716
Gene: ENSMUSG00000027425

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 20 83 1e-7 PFAM
Pfam:Acetyltransf_1 25 78 3.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139812
SMART Domains Protein: ENSMUSP00000128694
Gene: ENSMUSG00000027425

DomainStartEndE-ValueType
Pfam:Acetyltransf_10 2 64 7.1e-10 PFAM
Pfam:Acetyltransf_1 3 65 2.8e-11 PFAM
Pfam:Acetyltransf_7 3 66 3.4e-11 PFAM
Pfam:FR47 7 73 1.2e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000147747
AA Change: I388T

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130785
Gene: ENSMUSG00000027425
AA Change: I388T

DomainStartEndE-ValueType
low complexity region 99 123 N/A INTRINSIC
Pfam:Acetyltransf_10 428 537 6.3e-12 PFAM
Pfam:Acetyltransf_7 458 539 5.7e-12 PFAM
Pfam:Acetyltransf_1 464 538 3.1e-12 PFAM
Pfam:FR47 479 544 2.4e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CSRP2 is a protein containing two LIM domains, which are double zinc finger motifs found in proteins of diverse function. CSRP2 and some related proteins are thought to act as protein adapters, bridging two or more proteins to form a larger protein complex. The protein encoded by this gene binds to one of the LIM domains of CSRP2 and contains an acetyltransferase domain. Although the encoded protein has been detected in the cytoplasm, it is predominantly a nuclear protein. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, decreased size, increased apoptosis, and disrupted cell cycling. Mice heterozygous for one targeted allele exhibit corneal opacity. [provided by MGI curators]
Allele List at MGI

All alleles(54) : Targeted, other(1) Gene trapped(53)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
2810004N23Rik T C 8: 124,840,476 K229E probably damaging Het
4931409K22Rik T A 5: 24,549,449 I395F probably benign Het
9030624J02Rik T C 7: 118,752,895 probably null Het
Abca8b T C 11: 109,969,104 T523A probably damaging Het
Adamts18 G T 8: 113,764,310 D508E probably benign Het
Arap2 T C 5: 62,698,419 E558G probably benign Het
Arid4a A T 12: 71,072,600 D331V Het
Ash1l A T 3: 89,007,832 K1923M possibly damaging Het
Atad2b T A 12: 5,013,859 S947T probably benign Het
B4galt1 A T 4: 40,853,804 M1K probably null Het
BC025446 T A 15: 75,220,725 C98S probably damaging Het
Ccpg1 G A 9: 72,997,421 S4N unknown Het
Cfap43 A T 19: 47,897,871 L102M probably benign Het
Clic6 T C 16: 92,530,756 I483T possibly damaging Het
Col6a6 A T 9: 105,784,174 D245E probably benign Het
Cpsf7 G A 19: 10,540,849 probably null Het
Depdc5 A G 5: 32,934,010 D721G probably benign Het
Dhx29 C T 13: 112,947,328 T639I possibly damaging Het
Dock7 T C 4: 98,973,189 E1397G unknown Het
Dsp C T 13: 38,192,403 T1388M probably damaging Het
Fam186b C T 15: 99,285,544 G73D probably damaging Het
Ganab A G 19: 8,915,712 D960G probably damaging Het
Gm12394 G T 4: 42,793,833 Q100K probably benign Het
Gria1 T C 11: 57,309,789 V764A probably damaging Het
Grk3 T C 5: 112,915,047 K645E probably benign Het
Hecw2 A T 1: 53,839,029 Y1339* probably null Het
Hmcn2 C A 2: 31,426,833 T3808N probably damaging Het
Il20rb A T 9: 100,473,002 N129K possibly damaging Het
Itgb4 T C 11: 115,983,271 Y340H probably damaging Het
Itgb6 T C 2: 60,628,028 I460M probably benign Het
Kif1b A C 4: 149,238,010 D817E probably benign Het
Lamb2 T A 9: 108,480,561 C94* probably null Het
Larp1 T C 11: 58,051,064 S743P probably damaging Het
Ldlrap1 T C 4: 134,747,179 N267S probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Ltf T C 9: 111,021,996 L92P probably damaging Het
Mns1 C A 9: 72,452,608 Q347K probably benign Het
Myof A T 19: 37,960,926 F611I probably damaging Het
Nop56 T C 2: 130,275,681 L76P probably damaging Het
Nphp1 T C 2: 127,774,088 H114R Het
Olfr1280 T A 2: 111,316,053 N191K probably benign Het
Olfr1512 G C 14: 52,372,653 Y133* probably null Het
Olfr390 C A 11: 73,787,275 N112K possibly damaging Het
Park2 C A 17: 11,838,634 H301N possibly damaging Het
Pcdha12 A G 18: 37,020,939 D237G probably damaging Het
Pitpnm3 A T 11: 72,061,586 M593K possibly damaging Het
Plxdc1 C T 11: 97,954,855 V211I probably damaging Het
Prpf38a A T 4: 108,572,875 H143Q probably damaging Het
Sdk2 T C 11: 113,806,279 T1769A probably benign Het
Stab1 T C 14: 31,162,939 D153G possibly damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tnrc6b T A 15: 80,880,436 M713K probably benign Het
Top2a T C 11: 99,003,608 K966E possibly damaging Het
Vars2 T C 17: 35,662,135 T421A probably damaging Het
Vmn1r1 A T 1: 182,157,205 C298* probably null Het
Vwa3a T C 7: 120,804,030 probably null Het
Vwa5b1 G T 4: 138,588,629 Q601K possibly damaging Het
Zbtb46 T C 2: 181,395,488 K454E probably damaging Het
Zfp426 T C 9: 20,470,281 H470R probably benign Het
Other mutations in Kat14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Kat14 APN 2 144394255 missense probably benign 0.01
IGL01361:Kat14 APN 2 144406620 splice site probably null
IGL01958:Kat14 APN 2 144394365 missense probably damaging 1.00
IGL02499:Kat14 APN 2 144393831 missense probably benign 0.45
IGL02625:Kat14 APN 2 144402445 missense possibly damaging 0.79
IGL02814:Kat14 APN 2 144402463 missense probably benign
IGL02883:Kat14 APN 2 144393529 missense probably damaging 1.00
IGL03114:Kat14 APN 2 144375965 critical splice donor site probably null
A5278:Kat14 UTSW 2 144393307 nonsense probably null
R1446:Kat14 UTSW 2 144373718 missense probably damaging 1.00
R1517:Kat14 UTSW 2 144373791 missense probably benign 0.00
R1589:Kat14 UTSW 2 144394100 missense probably benign 0.06
R2071:Kat14 UTSW 2 144389216 missense probably damaging 1.00
R3911:Kat14 UTSW 2 144404062 missense probably damaging 1.00
R3951:Kat14 UTSW 2 144407329 utr 3 prime probably benign
R4167:Kat14 UTSW 2 144394110 missense probably damaging 1.00
R4624:Kat14 UTSW 2 144404220 intron probably benign
R4628:Kat14 UTSW 2 144404220 intron probably benign
R4629:Kat14 UTSW 2 144404220 intron probably benign
R4944:Kat14 UTSW 2 144375953 missense probably damaging 0.99
R5401:Kat14 UTSW 2 144389260 missense possibly damaging 0.77
R5429:Kat14 UTSW 2 144393323 missense probably benign 0.03
R7165:Kat14 UTSW 2 144393998 missense probably benign 0.03
R7453:Kat14 UTSW 2 144380734 missense possibly damaging 0.85
R7738:Kat14 UTSW 2 144394242 missense probably damaging 1.00
R9130:Kat14 UTSW 2 144373822 missense probably benign 0.30
R9260:Kat14 UTSW 2 144393521 missense probably benign 0.02
R9457:Kat14 UTSW 2 144373782 missense probably benign 0.02
R9480:Kat14 UTSW 2 144373825 missense probably damaging 1.00
R9502:Kat14 UTSW 2 144393607 missense probably damaging 1.00
X0018:Kat14 UTSW 2 144373857 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTTTACCTTTCCAATTAGGTGATC -3'
(R):5'- TGTGGCATCTAGACTAAAACAATG -3'

Sequencing Primer
(F):5'- TTAGGTGATCCAAAAAGACCTACTC -3'
(R):5'- TGCTCCAAGTCAGGCTAT -3'
Posted On 2022-06-15