Incidental Mutation 'R9450:Dock7'
ID 714179
Institutional Source Beutler Lab
Gene Symbol Dock7
Ensembl Gene ENSMUSG00000028556
Gene Name dedicator of cytokinesis 7
Synonyms m, LOC242555, 3110056M06Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 98824908-99009152 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98861426 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1397 (E1397G)
Ref Sequence ENSEMBL: ENSMUSP00000117797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000205650]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030286
AA Change: E1397G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556
AA Change: E1397G

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556
AA Change: E1367G

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124466
AA Change: E783G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000127417
AA Change: E1397G
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556
AA Change: E1397G

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205650
AA Change: E1367G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that plays a role in axon formation and neuronal polarization. The encoded protein displays GEF activity toward RAC1 and RAC3 Rho small GTPases but not toward CDC42. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit coat color dilution, white tail tip, and on some genetic backgrounds a white belly spot. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
2810004N23Rik T C 8: 125,567,215 (GRCm39) K229E probably damaging Het
Abca8b T C 11: 109,859,930 (GRCm39) T523A probably damaging Het
Adamts18 G T 8: 114,490,942 (GRCm39) D508E probably benign Het
Arap2 T C 5: 62,855,762 (GRCm39) E558G probably benign Het
Arid4a A T 12: 71,119,374 (GRCm39) D331V Het
Ash1l A T 3: 88,915,139 (GRCm39) K1923M possibly damaging Het
Atad2b T A 12: 5,063,859 (GRCm39) S947T probably benign Het
B4galt1 A T 4: 40,853,804 (GRCm39) M1K probably null Het
Ccpg1 G A 9: 72,904,703 (GRCm39) S4N unknown Het
Cfap43 A T 19: 47,886,310 (GRCm39) L102M probably benign Het
Clic6 T C 16: 92,327,644 (GRCm39) I483T possibly damaging Het
Col6a6 A T 9: 105,661,373 (GRCm39) D245E probably benign Het
Cpsf7 G A 19: 10,518,213 (GRCm39) probably null Het
Depdc5 A G 5: 33,091,354 (GRCm39) D721G probably benign Het
Dhx29 C T 13: 113,083,862 (GRCm39) T639I possibly damaging Het
Dsp C T 13: 38,376,379 (GRCm39) T1388M probably damaging Het
Fam186b C T 15: 99,183,425 (GRCm39) G73D probably damaging Het
Ganab A G 19: 8,893,076 (GRCm39) D960G probably damaging Het
Gria1 T C 11: 57,200,615 (GRCm39) V764A probably damaging Het
Grk3 T C 5: 113,062,913 (GRCm39) K645E probably benign Het
Hecw2 A T 1: 53,878,188 (GRCm39) Y1339* probably null Het
Hmcn2 C A 2: 31,316,845 (GRCm39) T3808N probably damaging Het
Il20rb A T 9: 100,355,055 (GRCm39) N129K possibly damaging Het
Iqca1l T A 5: 24,754,447 (GRCm39) I395F probably benign Het
Itgb4 T C 11: 115,874,097 (GRCm39) Y340H probably damaging Het
Itgb6 T C 2: 60,458,372 (GRCm39) I460M probably benign Het
Kat14 T C 2: 144,242,739 (GRCm39) I599T possibly damaging Het
Kif1b A C 4: 149,322,467 (GRCm39) D817E probably benign Het
Lamb2 T A 9: 108,357,760 (GRCm39) C94* probably null Het
Larp1 T C 11: 57,941,890 (GRCm39) S743P probably damaging Het
Ldlrap1 T C 4: 134,474,490 (GRCm39) N267S probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Ltf T C 9: 110,851,064 (GRCm39) L92P probably damaging Het
Ly6g2 T A 15: 75,092,574 (GRCm39) C98S probably damaging Het
Mns1 C A 9: 72,359,890 (GRCm39) Q347K probably benign Het
Myof A T 19: 37,949,374 (GRCm39) F611I probably damaging Het
Nop56 T C 2: 130,117,601 (GRCm39) L76P probably damaging Het
Nphp1 T C 2: 127,616,008 (GRCm39) H114R Het
Or10g3 G C 14: 52,610,110 (GRCm39) Y133* probably null Het
Or1e30 C A 11: 73,678,101 (GRCm39) N112K possibly damaging Het
Or4k36 T A 2: 111,146,398 (GRCm39) N191K probably benign Het
Pcdha12 A G 18: 37,153,992 (GRCm39) D237G probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Pitpnm3 A T 11: 71,952,412 (GRCm39) M593K possibly damaging Het
Plxdc1 C T 11: 97,845,681 (GRCm39) V211I probably damaging Het
Prkn C A 17: 12,057,521 (GRCm39) H301N possibly damaging Het
Prpf38a A T 4: 108,430,072 (GRCm39) H143Q probably damaging Het
Sdk2 T C 11: 113,697,105 (GRCm39) T1769A probably benign Het
Spata31f1e G T 4: 42,793,833 (GRCm39) Q100K probably benign Het
Stab1 T C 14: 30,884,896 (GRCm39) D153G possibly damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tnrc6b T A 15: 80,764,637 (GRCm39) M713K probably benign Het
Top2a T C 11: 98,894,434 (GRCm39) K966E possibly damaging Het
Vars2 T C 17: 35,973,027 (GRCm39) T421A probably damaging Het
Vmn1r1 A T 1: 181,984,770 (GRCm39) C298* probably null Het
Vps35l T C 7: 118,352,118 (GRCm39) probably null Het
Vwa3a T C 7: 120,403,253 (GRCm39) probably null Het
Vwa5b1 G T 4: 138,315,940 (GRCm39) Q601K possibly damaging Het
Zbtb46 T C 2: 181,037,281 (GRCm39) K454E probably damaging Het
Zfp426 T C 9: 20,381,577 (GRCm39) H470R probably benign Het
Other mutations in Dock7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dock7 APN 4 98,952,222 (GRCm39) missense probably damaging 1.00
IGL01126:Dock7 APN 4 98,861,789 (GRCm39) splice site probably benign
IGL01490:Dock7 APN 4 98,833,355 (GRCm39) unclassified probably benign
IGL01553:Dock7 APN 4 98,833,803 (GRCm39) nonsense probably null
IGL01728:Dock7 APN 4 98,850,568 (GRCm39) missense probably damaging 1.00
IGL01776:Dock7 APN 4 98,829,178 (GRCm39) missense possibly damaging 0.65
IGL01954:Dock7 APN 4 98,971,388 (GRCm39) missense probably damaging 0.99
IGL01985:Dock7 APN 4 98,911,614 (GRCm39) missense probably benign 0.35
IGL02054:Dock7 APN 4 98,861,646 (GRCm39) missense probably damaging 1.00
IGL02150:Dock7 APN 4 98,968,089 (GRCm39) splice site probably benign
IGL02153:Dock7 APN 4 98,846,304 (GRCm39) missense probably benign 0.15
IGL02183:Dock7 APN 4 98,847,228 (GRCm39) missense possibly damaging 0.89
IGL02494:Dock7 APN 4 98,877,471 (GRCm39) missense probably benign 0.18
IGL02618:Dock7 APN 4 98,971,265 (GRCm39) missense probably benign 0.00
IGL02634:Dock7 APN 4 98,877,533 (GRCm39) missense probably damaging 1.00
IGL02670:Dock7 APN 4 98,854,523 (GRCm39) splice site probably null
IGL02690:Dock7 APN 4 98,857,872 (GRCm39) missense possibly damaging 0.95
IGL02692:Dock7 APN 4 98,875,623 (GRCm39) missense probably damaging 1.00
IGL02833:Dock7 APN 4 98,833,732 (GRCm39) missense probably damaging 1.00
IGL02858:Dock7 APN 4 98,833,442 (GRCm39) nonsense probably null
IGL02875:Dock7 APN 4 98,864,231 (GRCm39) missense probably benign 0.00
IGL03027:Dock7 APN 4 98,958,450 (GRCm39) missense possibly damaging 0.71
IGL03027:Dock7 APN 4 98,866,164 (GRCm39) missense probably benign
IGL03032:Dock7 APN 4 98,854,585 (GRCm39) missense probably benign 0.02
IGL03104:Dock7 APN 4 98,847,260 (GRCm39) missense possibly damaging 0.60
IGL03136:Dock7 APN 4 98,892,028 (GRCm39) missense probably damaging 1.00
IGL03345:Dock7 APN 4 98,873,056 (GRCm39) missense possibly damaging 0.91
Beaming UTSW 4 98,967,992 (GRCm39) nonsense probably null
moonlight UTSW 4 0 () large deletion
Nocturn UTSW 4 98,952,199 (GRCm39) missense probably benign 0.00
sonata UTSW 4 98,889,364 (GRCm39) nonsense probably null
BB005:Dock7 UTSW 4 98,889,335 (GRCm39) missense
BB015:Dock7 UTSW 4 98,889,335 (GRCm39) missense
PIT4810001:Dock7 UTSW 4 98,833,796 (GRCm39) nonsense probably null
R0086:Dock7 UTSW 4 98,833,381 (GRCm39) missense probably damaging 1.00
R0242:Dock7 UTSW 4 98,850,517 (GRCm39) missense probably benign
R0242:Dock7 UTSW 4 98,850,517 (GRCm39) missense probably benign
R0245:Dock7 UTSW 4 98,943,586 (GRCm39) missense possibly damaging 0.64
R0308:Dock7 UTSW 4 98,873,051 (GRCm39) missense probably benign 0.07
R0556:Dock7 UTSW 4 98,833,426 (GRCm39) missense probably damaging 1.00
R0612:Dock7 UTSW 4 98,877,470 (GRCm39) missense probably benign 0.31
R0652:Dock7 UTSW 4 98,943,586 (GRCm39) missense possibly damaging 0.64
R0669:Dock7 UTSW 4 98,875,716 (GRCm39) missense probably benign 0.00
R0681:Dock7 UTSW 4 98,904,941 (GRCm39) missense probably damaging 1.00
R0725:Dock7 UTSW 4 98,833,528 (GRCm39) missense probably damaging 1.00
R0828:Dock7 UTSW 4 98,903,982 (GRCm39) missense probably damaging 1.00
R0837:Dock7 UTSW 4 98,877,495 (GRCm39) missense probably benign 0.01
R0962:Dock7 UTSW 4 98,833,432 (GRCm39) missense possibly damaging 0.85
R1140:Dock7 UTSW 4 98,953,643 (GRCm39) missense possibly damaging 0.82
R1476:Dock7 UTSW 4 98,967,672 (GRCm39) missense possibly damaging 0.52
R1614:Dock7 UTSW 4 98,949,517 (GRCm39) missense probably benign 0.12
R1625:Dock7 UTSW 4 98,850,433 (GRCm39) splice site probably null
R1640:Dock7 UTSW 4 98,833,483 (GRCm39) missense probably damaging 1.00
R1752:Dock7 UTSW 4 98,854,681 (GRCm39) missense probably damaging 1.00
R1941:Dock7 UTSW 4 98,872,952 (GRCm39) missense probably benign 0.09
R2020:Dock7 UTSW 4 98,847,338 (GRCm39) missense probably damaging 1.00
R2092:Dock7 UTSW 4 98,897,545 (GRCm39) missense possibly damaging 0.95
R2293:Dock7 UTSW 4 98,854,606 (GRCm39) missense probably damaging 1.00
R2424:Dock7 UTSW 4 98,833,544 (GRCm39) nonsense probably null
R3767:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3768:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3769:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3770:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3917:Dock7 UTSW 4 98,904,922 (GRCm39) missense probably damaging 1.00
R3943:Dock7 UTSW 4 98,880,668 (GRCm39) missense probably damaging 1.00
R4021:Dock7 UTSW 4 98,892,157 (GRCm39) splice site probably null
R4073:Dock7 UTSW 4 98,896,296 (GRCm39) missense probably benign 0.02
R4170:Dock7 UTSW 4 98,854,638 (GRCm39) missense probably damaging 0.99
R4180:Dock7 UTSW 4 98,904,973 (GRCm39) missense probably benign 0.05
R4261:Dock7 UTSW 4 98,892,123 (GRCm39) missense possibly damaging 0.78
R4321:Dock7 UTSW 4 98,960,691 (GRCm39) missense probably damaging 1.00
R4522:Dock7 UTSW 4 98,850,461 (GRCm39) missense probably damaging 1.00
R4582:Dock7 UTSW 4 98,892,153 (GRCm39) missense possibly damaging 0.90
R4648:Dock7 UTSW 4 98,857,881 (GRCm39) nonsense probably null
R4940:Dock7 UTSW 4 98,908,314 (GRCm39) missense probably damaging 1.00
R5090:Dock7 UTSW 4 98,879,648 (GRCm39) missense probably benign 0.04
R5374:Dock7 UTSW 4 98,877,275 (GRCm39) missense possibly damaging 0.81
R5392:Dock7 UTSW 4 98,896,243 (GRCm39) missense probably damaging 1.00
R5527:Dock7 UTSW 4 98,842,105 (GRCm39) intron probably benign
R5544:Dock7 UTSW 4 98,855,494 (GRCm39) missense probably damaging 1.00
R5556:Dock7 UTSW 4 98,832,972 (GRCm39) missense probably damaging 1.00
R5870:Dock7 UTSW 4 98,952,199 (GRCm39) missense probably benign 0.00
R5899:Dock7 UTSW 4 98,879,660 (GRCm39) missense probably benign
R6360:Dock7 UTSW 4 98,857,899 (GRCm39) missense probably benign 0.02
R6415:Dock7 UTSW 4 98,880,685 (GRCm39) missense probably damaging 1.00
R6468:Dock7 UTSW 4 98,855,464 (GRCm39) missense probably benign 0.15
R6562:Dock7 UTSW 4 98,879,647 (GRCm39) missense probably damaging 0.97
R6613:Dock7 UTSW 4 98,866,197 (GRCm39) missense probably damaging 0.99
R6703:Dock7 UTSW 4 98,834,909 (GRCm39) missense probably damaging 1.00
R6723:Dock7 UTSW 4 98,892,153 (GRCm39) missense possibly damaging 0.90
R6786:Dock7 UTSW 4 98,949,529 (GRCm39) missense probably benign 0.42
R7026:Dock7 UTSW 4 98,967,156 (GRCm39) missense probably benign
R7051:Dock7 UTSW 4 98,834,969 (GRCm39) missense probably damaging 1.00
R7074:Dock7 UTSW 4 98,833,445 (GRCm39) missense unknown
R7106:Dock7 UTSW 4 98,855,563 (GRCm39) missense unknown
R7147:Dock7 UTSW 4 98,849,654 (GRCm39) missense unknown
R7257:Dock7 UTSW 4 98,861,649 (GRCm39) missense unknown
R7334:Dock7 UTSW 4 98,864,180 (GRCm39) missense unknown
R7511:Dock7 UTSW 4 98,967,992 (GRCm39) nonsense probably null
R7511:Dock7 UTSW 4 98,949,519 (GRCm39) missense
R7729:Dock7 UTSW 4 98,943,683 (GRCm39) missense
R7928:Dock7 UTSW 4 98,889,335 (GRCm39) missense
R7984:Dock7 UTSW 4 98,877,303 (GRCm39) missense unknown
R8287:Dock7 UTSW 4 98,866,157 (GRCm39) missense unknown
R8439:Dock7 UTSW 4 98,971,266 (GRCm39) missense
R8466:Dock7 UTSW 4 98,952,336 (GRCm39) missense possibly damaging 0.70
R8758:Dock7 UTSW 4 98,949,555 (GRCm39) missense
R8849:Dock7 UTSW 4 98,904,986 (GRCm39) missense
R8944:Dock7 UTSW 4 98,829,243 (GRCm39) missense probably damaging 1.00
R8964:Dock7 UTSW 4 98,949,476 (GRCm39) missense
R9008:Dock7 UTSW 4 98,833,448 (GRCm39) nonsense probably null
R9040:Dock7 UTSW 4 98,889,364 (GRCm39) nonsense probably null
R9160:Dock7 UTSW 4 98,857,962 (GRCm39) missense unknown
R9168:Dock7 UTSW 4 98,953,643 (GRCm39) missense
R9189:Dock7 UTSW 4 98,877,350 (GRCm39) missense unknown
R9215:Dock7 UTSW 4 98,859,088 (GRCm39) missense unknown
R9243:Dock7 UTSW 4 98,857,871 (GRCm39) missense unknown
R9256:Dock7 UTSW 4 98,971,272 (GRCm39) missense
R9328:Dock7 UTSW 4 98,968,064 (GRCm39) missense
R9332:Dock7 UTSW 4 98,896,280 (GRCm39) missense
R9584:Dock7 UTSW 4 98,861,481 (GRCm39) nonsense probably null
R9631:Dock7 UTSW 4 98,854,560 (GRCm39) missense unknown
R9676:Dock7 UTSW 4 98,904,922 (GRCm39) missense probably damaging 1.00
R9701:Dock7 UTSW 4 98,846,384 (GRCm39) missense unknown
R9723:Dock7 UTSW 4 98,960,660 (GRCm39) missense
R9723:Dock7 UTSW 4 98,908,270 (GRCm39) missense
R9727:Dock7 UTSW 4 98,875,568 (GRCm39) missense unknown
R9777:Dock7 UTSW 4 98,877,464 (GRCm39) missense unknown
R9802:Dock7 UTSW 4 98,846,384 (GRCm39) missense unknown
X0027:Dock7 UTSW 4 98,892,090 (GRCm39) missense probably damaging 0.99
Z1176:Dock7 UTSW 4 98,833,462 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CAACAGCTCTTATGCTAGGGG -3'
(R):5'- CGGTTGTTAGATCTGCTTTACC -3'

Sequencing Primer
(F):5'- AGCTCTTATGCTAGGGGTGAAATTTC -3'
(R):5'- AGATCTGCTTTACCTGTGTGTATC -3'
Posted On 2022-06-15