Incidental Mutation 'R9450:Ldlrap1'
ID 714181
Institutional Source Beutler Lab
Gene Symbol Ldlrap1
Ensembl Gene ENSMUSG00000037295
Gene Name low density lipoprotein receptor adaptor protein 1
Synonyms Arh, Arh1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R9450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 134741554-134768024 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 134747179 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 267 (N267S)
Ref Sequence ENSEMBL: ENSMUSP00000036749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037828]
AlphaFold Q8C142
Predicted Effect probably damaging
Transcript: ENSMUST00000037828
AA Change: N267S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036749
Gene: ENSMUSG00000037295
AA Change: N267S

DomainStartEndE-ValueType
PTB 42 177 4.92e-40 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytosolic protein which contains a phosphotyrosine binding (PTD) domain. The PTD domain has been found to interact with the cytoplasmic tail of the LDL receptor. Mutations in this gene lead to LDL receptor malfunction and cause the disorder autosomal recessive hypercholesterolaemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have increased levels of circulating LDL cholesterol and total plasmsa cholesterol and are physiologically similar to humans with autosomal recessive hypercholesterolemia (ARH). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
2810004N23Rik T C 8: 124,840,476 K229E probably damaging Het
4931409K22Rik T A 5: 24,549,449 I395F probably benign Het
9030624J02Rik T C 7: 118,752,895 probably null Het
Abca8b T C 11: 109,969,104 T523A probably damaging Het
Adamts18 G T 8: 113,764,310 D508E probably benign Het
Arap2 T C 5: 62,698,419 E558G probably benign Het
Arid4a A T 12: 71,072,600 D331V Het
Ash1l A T 3: 89,007,832 K1923M possibly damaging Het
Atad2b T A 12: 5,013,859 S947T probably benign Het
B4galt1 A T 4: 40,853,804 M1K probably null Het
BC025446 T A 15: 75,220,725 C98S probably damaging Het
Ccpg1 G A 9: 72,997,421 S4N unknown Het
Cfap43 A T 19: 47,897,871 L102M probably benign Het
Clic6 T C 16: 92,530,756 I483T possibly damaging Het
Col6a6 A T 9: 105,784,174 D245E probably benign Het
Cpsf7 G A 19: 10,540,849 probably null Het
Depdc5 A G 5: 32,934,010 D721G probably benign Het
Dhx29 C T 13: 112,947,328 T639I possibly damaging Het
Dock7 T C 4: 98,973,189 E1397G unknown Het
Dsp C T 13: 38,192,403 T1388M probably damaging Het
Fam186b C T 15: 99,285,544 G73D probably damaging Het
Ganab A G 19: 8,915,712 D960G probably damaging Het
Gm12394 G T 4: 42,793,833 Q100K probably benign Het
Gria1 T C 11: 57,309,789 V764A probably damaging Het
Grk3 T C 5: 112,915,047 K645E probably benign Het
Hecw2 A T 1: 53,839,029 Y1339* probably null Het
Hmcn2 C A 2: 31,426,833 T3808N probably damaging Het
Il20rb A T 9: 100,473,002 N129K possibly damaging Het
Itgb4 T C 11: 115,983,271 Y340H probably damaging Het
Itgb6 T C 2: 60,628,028 I460M probably benign Het
Kat14 T C 2: 144,400,819 I599T possibly damaging Het
Kif1b A C 4: 149,238,010 D817E probably benign Het
Lamb2 T A 9: 108,480,561 C94* probably null Het
Larp1 T C 11: 58,051,064 S743P probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Ltf T C 9: 111,021,996 L92P probably damaging Het
Mns1 C A 9: 72,452,608 Q347K probably benign Het
Myof A T 19: 37,960,926 F611I probably damaging Het
Nop56 T C 2: 130,275,681 L76P probably damaging Het
Nphp1 T C 2: 127,774,088 H114R Het
Olfr1280 T A 2: 111,316,053 N191K probably benign Het
Olfr1512 G C 14: 52,372,653 Y133* probably null Het
Olfr390 C A 11: 73,787,275 N112K possibly damaging Het
Park2 C A 17: 11,838,634 H301N possibly damaging Het
Pcdha12 A G 18: 37,020,939 D237G probably damaging Het
Pitpnm3 A T 11: 72,061,586 M593K possibly damaging Het
Plxdc1 C T 11: 97,954,855 V211I probably damaging Het
Prpf38a A T 4: 108,572,875 H143Q probably damaging Het
Sdk2 T C 11: 113,806,279 T1769A probably benign Het
Stab1 T C 14: 31,162,939 D153G possibly damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tnrc6b T A 15: 80,880,436 M713K probably benign Het
Top2a T C 11: 99,003,608 K966E possibly damaging Het
Vars2 T C 17: 35,662,135 T421A probably damaging Het
Vmn1r1 A T 1: 182,157,205 C298* probably null Het
Vwa3a T C 7: 120,804,030 probably null Het
Vwa5b1 G T 4: 138,588,629 Q601K possibly damaging Het
Zbtb46 T C 2: 181,395,488 K454E probably damaging Het
Zfp426 T C 9: 20,470,281 H470R probably benign Het
Other mutations in Ldlrap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01076:Ldlrap1 APN 4 134749982 missense probably benign 0.03
IGL02303:Ldlrap1 APN 4 134757395 missense probably damaging 1.00
R0129:Ldlrap1 UTSW 4 134757422 missense probably damaging 1.00
R3841:Ldlrap1 UTSW 4 134750436 missense probably damaging 0.97
R4233:Ldlrap1 UTSW 4 134757338 splice site probably null
R4884:Ldlrap1 UTSW 4 134758971 missense probably benign
R5871:Ldlrap1 UTSW 4 134758929 missense probably damaging 1.00
R6221:Ldlrap1 UTSW 4 134757360 missense probably damaging 0.96
R6222:Ldlrap1 UTSW 4 134757360 missense probably damaging 0.96
R6232:Ldlrap1 UTSW 4 134759034 missense possibly damaging 0.82
R6939:Ldlrap1 UTSW 4 134767974 start gained probably benign
R7472:Ldlrap1 UTSW 4 134758996 missense possibly damaging 0.61
R8407:Ldlrap1 UTSW 4 134757425 missense probably damaging 1.00
R8737:Ldlrap1 UTSW 4 134767836 missense probably benign 0.05
R9764:Ldlrap1 UTSW 4 134749350 missense probably benign 0.00
R9800:Ldlrap1 UTSW 4 134749992 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTATGGTCCGTCCCATGTCTAG -3'
(R):5'- CTCTGTTAGAGCAGGGTATCACG -3'

Sequencing Primer
(F):5'- TCCCATGTCTAGGCCAGTAGTG -3'
(R):5'- CAGGGTATCACGGCTCTGATTC -3'
Posted On 2022-06-15