Incidental Mutation 'R9450:Grk3'
ID 714187
Institutional Source Beutler Lab
Gene Symbol Grk3
Ensembl Gene ENSMUSG00000042249
Gene Name G protein-coupled receptor kinase 3
Synonyms Adrbk-2, beta ARK2, 4833444A01Rik, Bark-2, Adrbk2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 113058344-113163518 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113062913 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 645 (K645E)
Ref Sequence ENSEMBL: ENSMUSP00000070445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065167] [ENSMUST00000197888] [ENSMUST00000200332]
AlphaFold Q3UYH7
Predicted Effect probably benign
Transcript: ENSMUST00000065167
AA Change: K645E

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000070445
Gene: ENSMUSG00000042249
AA Change: K645E

DomainStartEndE-ValueType
RGS 54 175 1.44e-28 SMART
S_TKc 191 453 8.94e-85 SMART
S_TK_X 454 530 2.19e-10 SMART
PH 559 654 8.45e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197888
SMART Domains Protein: ENSMUSP00000142968
Gene: ENSMUSG00000042249

DomainStartEndE-ValueType
RGS 12 133 1.44e-28 SMART
S_TKc 149 411 8.94e-85 SMART
S_TK_X 412 488 2.19e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200332
SMART Domains Protein: ENSMUSP00000142926
Gene: ENSMUSG00000042249

DomainStartEndE-ValueType
PDB:3V5W|A 1 88 6e-42 PDB
SCOP:d1dk8a_ 48 88 2e-4 SMART
Blast:RGS 54 88 1e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The beta-adrenergic receptor kinase specifically phosphorylates the agonist-occupied form of the beta-adrenergic and related G protein-coupled receptors. Overall, the beta adrenergic receptor kinase 2 has 85% amino acid similarity with beta adrenergic receptor kinase 1, with the protein kinase catalytic domain having 95% similarity. These data suggest the existence of a family of receptor kinases which may serve broadly to regulate receptor function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation of this gene appear normal and are fertile, but exhibit a lack of odorant receptor-mediated desensitization in the olfactory epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
2810004N23Rik T C 8: 125,567,215 (GRCm39) K229E probably damaging Het
Abca8b T C 11: 109,859,930 (GRCm39) T523A probably damaging Het
Adamts18 G T 8: 114,490,942 (GRCm39) D508E probably benign Het
Arap2 T C 5: 62,855,762 (GRCm39) E558G probably benign Het
Arid4a A T 12: 71,119,374 (GRCm39) D331V Het
Ash1l A T 3: 88,915,139 (GRCm39) K1923M possibly damaging Het
Atad2b T A 12: 5,063,859 (GRCm39) S947T probably benign Het
B4galt1 A T 4: 40,853,804 (GRCm39) M1K probably null Het
Ccpg1 G A 9: 72,904,703 (GRCm39) S4N unknown Het
Cfap43 A T 19: 47,886,310 (GRCm39) L102M probably benign Het
Clic6 T C 16: 92,327,644 (GRCm39) I483T possibly damaging Het
Col6a6 A T 9: 105,661,373 (GRCm39) D245E probably benign Het
Cpsf7 G A 19: 10,518,213 (GRCm39) probably null Het
Depdc5 A G 5: 33,091,354 (GRCm39) D721G probably benign Het
Dhx29 C T 13: 113,083,862 (GRCm39) T639I possibly damaging Het
Dock7 T C 4: 98,861,426 (GRCm39) E1397G unknown Het
Dsp C T 13: 38,376,379 (GRCm39) T1388M probably damaging Het
Fam186b C T 15: 99,183,425 (GRCm39) G73D probably damaging Het
Ganab A G 19: 8,893,076 (GRCm39) D960G probably damaging Het
Gria1 T C 11: 57,200,615 (GRCm39) V764A probably damaging Het
Hecw2 A T 1: 53,878,188 (GRCm39) Y1339* probably null Het
Hmcn2 C A 2: 31,316,845 (GRCm39) T3808N probably damaging Het
Il20rb A T 9: 100,355,055 (GRCm39) N129K possibly damaging Het
Iqca1l T A 5: 24,754,447 (GRCm39) I395F probably benign Het
Itgb4 T C 11: 115,874,097 (GRCm39) Y340H probably damaging Het
Itgb6 T C 2: 60,458,372 (GRCm39) I460M probably benign Het
Kat14 T C 2: 144,242,739 (GRCm39) I599T possibly damaging Het
Kif1b A C 4: 149,322,467 (GRCm39) D817E probably benign Het
Lamb2 T A 9: 108,357,760 (GRCm39) C94* probably null Het
Larp1 T C 11: 57,941,890 (GRCm39) S743P probably damaging Het
Ldlrap1 T C 4: 134,474,490 (GRCm39) N267S probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Ltf T C 9: 110,851,064 (GRCm39) L92P probably damaging Het
Ly6g2 T A 15: 75,092,574 (GRCm39) C98S probably damaging Het
Mns1 C A 9: 72,359,890 (GRCm39) Q347K probably benign Het
Myof A T 19: 37,949,374 (GRCm39) F611I probably damaging Het
Nop56 T C 2: 130,117,601 (GRCm39) L76P probably damaging Het
Nphp1 T C 2: 127,616,008 (GRCm39) H114R Het
Or10g3 G C 14: 52,610,110 (GRCm39) Y133* probably null Het
Or1e30 C A 11: 73,678,101 (GRCm39) N112K possibly damaging Het
Or4k36 T A 2: 111,146,398 (GRCm39) N191K probably benign Het
Pcdha12 A G 18: 37,153,992 (GRCm39) D237G probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Pitpnm3 A T 11: 71,952,412 (GRCm39) M593K possibly damaging Het
Plxdc1 C T 11: 97,845,681 (GRCm39) V211I probably damaging Het
Prkn C A 17: 12,057,521 (GRCm39) H301N possibly damaging Het
Prpf38a A T 4: 108,430,072 (GRCm39) H143Q probably damaging Het
Sdk2 T C 11: 113,697,105 (GRCm39) T1769A probably benign Het
Spata31f1e G T 4: 42,793,833 (GRCm39) Q100K probably benign Het
Stab1 T C 14: 30,884,896 (GRCm39) D153G possibly damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tnrc6b T A 15: 80,764,637 (GRCm39) M713K probably benign Het
Top2a T C 11: 98,894,434 (GRCm39) K966E possibly damaging Het
Vars2 T C 17: 35,973,027 (GRCm39) T421A probably damaging Het
Vmn1r1 A T 1: 181,984,770 (GRCm39) C298* probably null Het
Vps35l T C 7: 118,352,118 (GRCm39) probably null Het
Vwa3a T C 7: 120,403,253 (GRCm39) probably null Het
Vwa5b1 G T 4: 138,315,940 (GRCm39) Q601K possibly damaging Het
Zbtb46 T C 2: 181,037,281 (GRCm39) K454E probably damaging Het
Zfp426 T C 9: 20,381,577 (GRCm39) H470R probably benign Het
Other mutations in Grk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Grk3 APN 5 113,133,685 (GRCm39) missense probably damaging 1.00
IGL01359:Grk3 APN 5 113,085,626 (GRCm39) missense probably damaging 1.00
IGL02318:Grk3 APN 5 113,085,669 (GRCm39) missense probably damaging 1.00
IGL02612:Grk3 APN 5 113,117,100 (GRCm39) missense probably benign 0.27
R0142:Grk3 UTSW 5 113,062,919 (GRCm39) missense probably damaging 1.00
R0589:Grk3 UTSW 5 113,076,629 (GRCm39) splice site probably benign
R0607:Grk3 UTSW 5 113,067,919 (GRCm39) missense probably damaging 1.00
R1459:Grk3 UTSW 5 113,062,878 (GRCm39) missense probably benign 0.10
R1554:Grk3 UTSW 5 113,117,135 (GRCm39) missense possibly damaging 0.76
R1640:Grk3 UTSW 5 113,163,248 (GRCm39) missense probably benign 0.36
R1657:Grk3 UTSW 5 113,114,848 (GRCm39) missense probably damaging 1.00
R1789:Grk3 UTSW 5 113,089,584 (GRCm39) missense probably damaging 1.00
R2401:Grk3 UTSW 5 113,062,849 (GRCm39) missense probably benign
R3735:Grk3 UTSW 5 113,101,697 (GRCm39) missense probably benign 0.00
R4024:Grk3 UTSW 5 113,062,850 (GRCm39) missense possibly damaging 0.77
R4025:Grk3 UTSW 5 113,062,850 (GRCm39) missense possibly damaging 0.77
R4392:Grk3 UTSW 5 113,068,002 (GRCm39) missense probably damaging 1.00
R4439:Grk3 UTSW 5 113,094,543 (GRCm39) splice site probably null
R4589:Grk3 UTSW 5 113,089,584 (GRCm39) missense possibly damaging 0.87
R4646:Grk3 UTSW 5 113,077,586 (GRCm39) missense probably benign 0.04
R5154:Grk3 UTSW 5 113,089,583 (GRCm39) missense probably damaging 1.00
R5462:Grk3 UTSW 5 113,117,074 (GRCm39) missense probably damaging 1.00
R5764:Grk3 UTSW 5 113,114,776 (GRCm39) critical splice donor site probably null
R5790:Grk3 UTSW 5 113,114,842 (GRCm39) missense possibly damaging 0.80
R6516:Grk3 UTSW 5 113,109,415 (GRCm39) intron probably benign
R6848:Grk3 UTSW 5 113,133,641 (GRCm39) missense probably damaging 0.98
R7857:Grk3 UTSW 5 113,109,427 (GRCm39) missense unknown
R7873:Grk3 UTSW 5 113,077,552 (GRCm39) missense probably benign 0.03
R8029:Grk3 UTSW 5 113,109,508 (GRCm39) missense probably benign
R8132:Grk3 UTSW 5 113,109,355 (GRCm39) missense unknown
R8204:Grk3 UTSW 5 113,105,225 (GRCm39) missense probably benign 0.17
R8903:Grk3 UTSW 5 113,066,697 (GRCm39) missense possibly damaging 0.89
R9794:Grk3 UTSW 5 113,121,448 (GRCm39) critical splice acceptor site probably null
RF021:Grk3 UTSW 5 113,089,554 (GRCm39) missense probably benign 0.20
Z1176:Grk3 UTSW 5 113,105,180 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTGTGTCTTAGCCCCACAC -3'
(R):5'- TTGTCTCACCAGGTTCCCAG -3'

Sequencing Primer
(F):5'- TTCCACTCCTGGGCTGAAGAG -3'
(R):5'- TTCCCAGGGACTCGAAGGTAG -3'
Posted On 2022-06-15