Incidental Mutation 'R9450:Il20rb'
ID 714197
Institutional Source Beutler Lab
Gene Symbol Il20rb
Ensembl Gene ENSMUSG00000044244
Gene Name interleukin 20 receptor beta
Synonyms LOC213208, Il20R2, Fndc6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 100457719-100486788 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 100473002 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 129 (N129K)
Ref Sequence ENSEMBL: ENSMUSP00000096057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098458]
AlphaFold E9Q9A6
Predicted Effect possibly damaging
Transcript: ENSMUST00000098458
AA Change: N129K

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096057
Gene: ENSMUSG00000044244
AA Change: N129K

DomainStartEndE-ValueType
FN3 30 117 9.09e0 SMART
Pfam:Interfer-bind 131 222 7.6e-9 PFAM
transmembrane domain 228 250 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IL20RB and IL20RA (MIM 605620) form a heterodimeric receptor for interleukin-20 (IL20; MIM 605619) (Blumberg et al., 2001 [PubMed 11163236]).[supplied by OMIM, Feb 2009]
PHENOTYPE: Mice homozygous for a knock-out allele display enhanced antigen-specific T cell responses. Mice homozygous for a reporter allele fail to exhibit epidermal hyperplasia in an interleukin-23 (IL-23)-dependent psoriasis mouse model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
2810004N23Rik T C 8: 124,840,476 K229E probably damaging Het
4931409K22Rik T A 5: 24,549,449 I395F probably benign Het
9030624J02Rik T C 7: 118,752,895 probably null Het
Abca8b T C 11: 109,969,104 T523A probably damaging Het
Adamts18 G T 8: 113,764,310 D508E probably benign Het
Arap2 T C 5: 62,698,419 E558G probably benign Het
Arid4a A T 12: 71,072,600 D331V Het
Ash1l A T 3: 89,007,832 K1923M possibly damaging Het
Atad2b T A 12: 5,013,859 S947T probably benign Het
B4galt1 A T 4: 40,853,804 M1K probably null Het
BC025446 T A 15: 75,220,725 C98S probably damaging Het
Ccpg1 G A 9: 72,997,421 S4N unknown Het
Cfap43 A T 19: 47,897,871 L102M probably benign Het
Clic6 T C 16: 92,530,756 I483T possibly damaging Het
Col6a6 A T 9: 105,784,174 D245E probably benign Het
Cpsf7 G A 19: 10,540,849 probably null Het
Depdc5 A G 5: 32,934,010 D721G probably benign Het
Dhx29 C T 13: 112,947,328 T639I possibly damaging Het
Dock7 T C 4: 98,973,189 E1397G unknown Het
Dsp C T 13: 38,192,403 T1388M probably damaging Het
Fam186b C T 15: 99,285,544 G73D probably damaging Het
Ganab A G 19: 8,915,712 D960G probably damaging Het
Gm12394 G T 4: 42,793,833 Q100K probably benign Het
Gria1 T C 11: 57,309,789 V764A probably damaging Het
Grk3 T C 5: 112,915,047 K645E probably benign Het
Hecw2 A T 1: 53,839,029 Y1339* probably null Het
Hmcn2 C A 2: 31,426,833 T3808N probably damaging Het
Itgb4 T C 11: 115,983,271 Y340H probably damaging Het
Itgb6 T C 2: 60,628,028 I460M probably benign Het
Kat14 T C 2: 144,400,819 I599T possibly damaging Het
Kif1b A C 4: 149,238,010 D817E probably benign Het
Lamb2 T A 9: 108,480,561 C94* probably null Het
Larp1 T C 11: 58,051,064 S743P probably damaging Het
Ldlrap1 T C 4: 134,747,179 N267S probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Ltf T C 9: 111,021,996 L92P probably damaging Het
Mns1 C A 9: 72,452,608 Q347K probably benign Het
Myof A T 19: 37,960,926 F611I probably damaging Het
Nop56 T C 2: 130,275,681 L76P probably damaging Het
Nphp1 T C 2: 127,774,088 H114R Het
Olfr1280 T A 2: 111,316,053 N191K probably benign Het
Olfr1512 G C 14: 52,372,653 Y133* probably null Het
Olfr390 C A 11: 73,787,275 N112K possibly damaging Het
Park2 C A 17: 11,838,634 H301N possibly damaging Het
Pcdha12 A G 18: 37,020,939 D237G probably damaging Het
Pitpnm3 A T 11: 72,061,586 M593K possibly damaging Het
Plxdc1 C T 11: 97,954,855 V211I probably damaging Het
Prpf38a A T 4: 108,572,875 H143Q probably damaging Het
Sdk2 T C 11: 113,806,279 T1769A probably benign Het
Stab1 T C 14: 31,162,939 D153G possibly damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tnrc6b T A 15: 80,880,436 M713K probably benign Het
Top2a T C 11: 99,003,608 K966E possibly damaging Het
Vars2 T C 17: 35,662,135 T421A probably damaging Het
Vmn1r1 A T 1: 182,157,205 C298* probably null Het
Vwa3a T C 7: 120,804,030 probably null Het
Vwa5b1 G T 4: 138,588,629 Q601K possibly damaging Het
Zbtb46 T C 2: 181,395,488 K454E probably damaging Het
Zfp426 T C 9: 20,470,281 H470R probably benign Het
Other mutations in Il20rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Il20rb APN 9 100473154 missense probably damaging 1.00
IGL02943:Il20rb APN 9 100466252 missense probably benign 0.00
IGL03368:Il20rb APN 9 100459121 utr 3 prime probably benign
IGL03396:Il20rb APN 9 100459198 missense probably damaging 0.99
IGL03412:Il20rb APN 9 100474996 missense probably benign 0.00
R0157:Il20rb UTSW 9 100473079 missense probably damaging 1.00
R4591:Il20rb UTSW 9 100474990 missense possibly damaging 0.61
R4948:Il20rb UTSW 9 100461539 splice site probably benign
R5622:Il20rb UTSW 9 100486318 missense probably benign 0.15
R6448:Il20rb UTSW 9 100474933 missense probably benign 0.03
R7013:Il20rb UTSW 9 100461428 missense probably benign 0.10
R7502:Il20rb UTSW 9 100468426 missense probably damaging 0.98
R7916:Il20rb UTSW 9 100466251 missense probably benign 0.01
R8015:Il20rb UTSW 9 100474894 missense probably damaging 1.00
R8234:Il20rb UTSW 9 100459210 missense probably benign 0.01
R9143:Il20rb UTSW 9 100474883 missense probably damaging 1.00
R9381:Il20rb UTSW 9 100461488 missense possibly damaging 0.60
R9595:Il20rb UTSW 9 100486258 missense possibly damaging 0.91
R9727:Il20rb UTSW 9 100474948 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATAAGAATCCCAGTGCCCATG -3'
(R):5'- TACGAGAGCCTGTACATGAGC -3'

Sequencing Primer
(F):5'- TGGAATGTCCATACCCGTGG -3'
(R):5'- TGTACATGAGCCACATCTGG -3'
Posted On 2022-06-15